Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Luscinia cyane

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTATACCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATCCGAGCAGAGCTGGGCCAACCAGGCGCCTTACTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCTCATGCCTTTGTAATAATCTTCTTTATAGTTATACCAATTATAATTGGAGGATTCGGAAACTGACTAGTCCCTCTAATAATTGGAGCACCAGACATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTACTTCCTCCATCTTTCCTGCTTCTCCTAGCCTCCTCTACAGTCGAAGCAGGAGTAGGAACAGGCTGAACTGTATACCCACCACTTGCCGGCAATCTCGCCCATGCTGGAGCCTCAGTAGACCTAGCTATCTTCTCCCTTCACCTAGCAGGTATTTCTTCAATCCTAGGTGCCATCAACTTCATCACTACAGCAATCAATATAAAACCCCCTGCCCTTTCACAATACCAAACACCCCTATTCGTTTGATCCGTACTAATCACCGCAGTCCTACTTCTCCTATCCCTTCCCGTTCTTGCCGCCGGCATCACAATGCTCCTCACTGACCGCAACCTAAACACCACTTTCTTCGACCCTGCGGGAGGGGGAGACCCAGTACTTTATCAACACCTTTTCTGATTCTTTGGCCATCCAGAAGTATACATTCTAATCCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Luscinia cyane

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common throughout its range, except for northern Vietnam, where it is rare (del Hoyo et al. 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Siberian Blue Robin

The Siberian Blue Robin, Luscinia cyane, is a small passerine bird that was formerly classed as a member of the thrush family Turdidae, but is now more generally considered to be an Old World flycatcher, family Muscicapidae. It, and similar small European species, are often called chats. Recent research suggests that this species is one of some East Asian Luscinias which should be classified in a new genus together with the Japanese and Ryūkyū Robins.[2]

It is a migratory insectivorous species breeding in eastern Asia across to Japan. It winters in southeast Asia and Indonesia.

The breeding habitat is coniferous forest with dense undergrowth, often beside rivers or at woodland edges. It feeds on the ground but is very skulking. In winter, this bird also tends to stay in dense vegetation.

This species is larger than the European Robin. The breeding male is unmistakable with blue upperparts and white underparts. The female is much drabber, with brown upperparts and whitish underparts. Her dark eye stands out against the paler brown face.

This species is a very rare vagrant to Europe, and has vagrant status even as far east as Pakistan.

References

  1. ^ BirdLife International (2012). "Luscinia cyane". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ Seki, Shin-Ichi (2006). "The origin of the East Asian Erithacus robin, Erithacus komadori, inferred from cytochrome b sequence data". Molecular Phylogenetics and Evolution 39 (3): 899–905. doi:10.1016/j.ympev.2006.01.028. PMID 16529957. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!