Articles on this page are available in 2 other languages: Chinese (Simplified) (11), Dutch (1) (learn more)

Overview

Brief Summary

Siskins are true seed-feeders. In the summer, they eat seed from half-opened pine spruce apples. In the winter, they eat mostly seed from alder and birch. You then find them a lot in parks, gardens and other such areas. Sometimes, they hang upside down on alder-cones just like tits, in order to pick out the seed. Male siskins have a striking appearance with their yellow color and black cap.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

N Palearctic; winters Mediterranean region, China and Ryukyu Is..
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.705 - 9.408
  Nitrate (umol/L): 1.335 - 2.144
  Salinity (PPS): 6.218 - 6.428
  Oxygen (ml/l): 7.967 - 8.325
  Phosphate (umol/l): 0.243 - 0.273
  Silicate (umol/l): 9.916 - 10.160

Graphical representation

Temperature range (°C): 7.705 - 9.408

Nitrate (umol/L): 1.335 - 2.144

Salinity (PPS): 6.218 - 6.428

Oxygen (ml/l): 7.967 - 8.325

Phosphate (umol/l): 0.243 - 0.273

Silicate (umol/l): 9.916 - 10.160
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 5 specimens in 1 taxon.
Water temperature and chemistry ranges based on 3 samples.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 7.705 - 9.408
  Nitrate (umol/L): 1.335 - 2.144
  Salinity (PPS): 6.218 - 6.428
  Oxygen (ml/l): 7.967 - 8.325
  Phosphate (umol/l): 0.243 - 0.273
  Silicate (umol/l): 9.916 - 10.160

Graphical representation

Temperature range (°C): 7.705 - 9.408

Nitrate (umol/L): 1.335 - 2.144

Salinity (PPS): 6.218 - 6.428

Oxygen (ml/l): 7.967 - 8.325

Phosphate (umol/l): 0.243 - 0.273

Silicate (umol/l): 9.916 - 10.160
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 13.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Carduelis spinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 19 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTATACCTAATTTTTGGCGCATGAGCCGGAATAGTAGGCACCGCCCTAAGCCTTCTCATCCGAGCAGAATTAGGTCAACCCGGAGCCCTCCTAGGAGACGACCAAGTCTACAACGTAATCGTCACGGCCCATGCTTTCGTCATAATCTTTTTCATAGTTATACCCATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCACGAATAAATAACATAAGCTTCTGACTACTCCCCCCATCATTCCTCCTCCTACTAGCATCCTCCACCGTAGAAGCAGGTGTTGGTACAGGTTGAACAGTGTACCCTCCACTAGCTGGTAACCTAGCCCATGCCGGAGCTTCAGTTGACCTAGCAATCTTCTCCCTACACCTAGCCGGTATTTCTTCAATTCTAGGTGCAATCAACTTCATCACAACAGCAATCAATATAAAACCCCCTGCTCTCTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTAATTACTGCAGTACTCCTACTCCTTTCCCTCCCAGTCCTTGCTGCAGGAATTACAATGCTTCTCACAGACCGCAACCTCAACACCACATTCTTCGACCCTGCAGGAGGAGGTGACCCAGTCCTATATCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTCATCCTCCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Carduelis spinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 21
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2014
    Least Concern (LC)
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5