Overview

Brief Summary

Baeolophus bicolor

A familiar songbird at bird feeders across the eastern U.S., the Tufted Titmouse is easily identified in most of its range by its sparrow-sized (6 inches) light grey body, chestnut flanks, and striking gray crest. In central Texas, this species is replaced by (and overlaps with) the Black-crested Titmouse (Baeolophus atricristatus), which has a dark crest and darker body. Males and females are similar at all seasons. The Tufted Titmouse is a common resident in the eastern United States, absent only from northernmost New England and Maine, northern Michigan and Wisconsin, and southernmost Florida. Historically this species had a more southern distribution; in the last century, increased numbers of bird feeders have helped the Tufted Titmouse expand its range northward. This species is a permanent resident across its range. Tufted Titmice are generally found in deciduous woodland habitats. More recently, they have also adapted to life in suburban and light urban settings, especially in areas with high concentrations of bird feeders. The Tufted Titmouse’s diet consists primarily of seeds, but Titmice will also take insects when available. Titmice are most easily observed while visiting bird feeders; in fact, many yards in this species’ range are visited by Titmice every day. In wilder areas, this species may be looked for in the forest canopy, often associating with Chickadees. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

S-central Canada (Ontario) to e, central and se US.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tufted titmice are only native to the Nearctic region. They are common east of the Great Plains in the woodlands of the southeastern, eastern, and midwestern United States, and in southern Ontario. Tufted titmice were once known only from the Ohio and Mississippi river drainages. Since the 1940's they have expanded throughout the eastern seaboard and now continue to expand their range northwards into Canada.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Tufted titmice are only native to the Nearctic region. They are common east of the Great Plains in the woodlands of the southeastern, eastern, and midwestern United States, and in southern Ontario. Tufted titmice were once known only from the Ohio and Mississippi river drainages. Since the 1940's they have expanded throughout the eastern seaboard and now continue to expand their range northwards into Canada.

Biogeographic Regions: nearctic (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (200,000 to >2,500,000 square km (about 80,000 to >1,000,000 square miles)) Resident from northeastern Nebraska east across southern Great Lakes region to southern New England, south to eastern Texas, Gulf Coast, and southern Florida; and west to central Kansas and west-central Oklahoma (AOU 1998, Banks et al. 2002).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tufted titmice are 15 to 17 cm long and have wingspans of 23 to 28 cm. Both males and females have white undersides, gray backs, rusty-brown sides, pointed crests on their heads, and large dark eyes.

Range length: 15 to 17 cm.

Range wingspan: 23 to 28 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 21 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Tufted titmice are 15 to 17 cm long and have wingspans of 23 to 28 cm. Both males and females have white undersides, gray backs, rusty-brown sides, pointed crests on their heads, and large dark eyes.

Range length: 15 to 17 cm.

Range wingspan: 23 to 28 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 21 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 17 cm

Weight: 22 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Type Information

Type for Parus bicolor bicolor
Catalog Number: USNM A6752
Collection: Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds
Sex/Stage: unknown; Adult
Preparation: Skin: Whole
Collector(s): D. Couch
Year Collected: 1855
Locality: Fort Leavenworth, Leavenworth, Kansas, United States, North America
  • Type: Baird. 1858. Rep. Expl. And Surv. R.R. Pac. 9: xxxvi, 384.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Smithsonian Institution, National Museum of Natural History, Department of Vertebrate Zoology, Division of Birds

Source: National Museum of Natural History Image Collection

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Tufted titmice prefer deciduous woodlands, especially moist woodlands found in swamps and river basins. They are also common in wooded residential areas and city parks.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tufted titmice prefer deciduous woodlands, especially moist woodlands found in swamps and river basins. They are also common in wooded residential areas and city parks.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: suburban ; riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Forest, woodland, scrub, and partly open situations with scattered trees, from deciduous and mixed woodland in the northeast to oak-juniper scrub, mesquite, and riparian woodland in the southwest; also wooded parks and residential areas (AOU 1998). Nests in natural cavity in tree, or in old woodpecker hole, or in artificial cavity such as pipe, bird box, 1-27 m above ground (Harrison 1978).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Tufted titmice eat a wide variety of insect and invertebrate prey, including Lepidoptera, Diptera, Insecta eggs, Gastropoda, and Araneae. They also eat berries and seeds. They hold seeds under their feet on branches and crack them with their sharp bills. Tufted titmice are common at bird feeders where they eat seeds, especially sunflower seeds, suet, and other offerings.

Animal Foods: eggs; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Food Habits

Tufted titmice eat a wide variety of insect and invertebrate prey, including caterpillars, moths, flies, insect eggs, snails, and spiders. They also eat berries and seeds. They hold seeds under their feet on branches and crack them with their sharp bills. Tufted titmice are common at bird feeders where they eat seeds, especially sunflower seeds, suet, and other offerings.

Animal Foods: eggs; insects; terrestrial non-insect arthropods; mollusks

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects, spiders, small fruits, and seeds (Terres 1980); the latter two items eaten most abundantly in colder months.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Tufted titmice nestlings are preyed upon by a number of animals. They also control insect populations and distribute nuts by carring them away to eat them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tufted titmice nestlings are preyed upon by nest predators such as Squamata, Procyon lotor, Mephitis mephitis, Didelphis virginiana, and Sciuridae. Adults are preyed upon by Felis silvestris and predatory birds such as Accipitridae and Strigiformes. In the eastern United States the most common birds of prey that hunt tufted titmice are Accipiter striatus and Accipiter cooperi. Tufted titmice give off high-pitched alarm calls when hawks are seen flying overhead.

Known Predators:

  • Cooper's hawks (Accipiter_cooperii)
  • sharp-shinned hawk (Accipiter_striatus)
  • owls (Strigiformes)
  • racoons (Procyon_lotor)
  • snakes (Squamata)
  • skunks (Mephitis_mephitis)
  • Virginia opossums (Didelphis_virginiana)
  • squirrels (Sciuridae)
  • domestic cats (Felis_silvestris)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Tufted titmice nestlings are preyed upon by a number of animals. They also control insect populations and distribute nuts by carring them away to eat them.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Tufted titmice nestlings are preyed upon by nest predators such as snakes, raccoons, skunks, opossums, and squirrels. Adults are preyed upon by cats and predatory birds such as hawks and owls. In the eastern United States the most common birds of prey that hunt tufted titmice are sharp-shinned hawks and Cooper's hawks. Tufted titmice give off high-pitched alarm calls when hawks are seen flying overhead.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Baeolophus bicolor (tufted titmouse) preys on:
Orthoptera
Diptera
Auchenorrhyncha
Sternorrhyncha
Coleoptera
Hymenoptera
Arachnida

Based on studies in:
USA: Illinois (Forest)

This list may not be complete but is based on published studies.
  • A. C. Twomey, The bird population of an elm-maple forest with special reference to aspection, territorialism, and coactions, Ecol. Monogr. 15(2):175-205, from p. 202 (1945).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Titmice calls sound like: "peto, peto, peto" or "peter, peter, peter", and "day-day-day". One can call them to you by imitating this call. There are 10 different known calls of tufted titmice. The calls are generally divided into 2 groups. One group is made up of calls that have a very low frequency and the others have a very high frequency. The three calls in the group of high-frequency calls are usually associated with agressive behavior. Tufted titmice also communicate among themselves using body posture and movements.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Communication and Perception

Titmice calls sound like: "peto, peto, peto" or "peter, peter, peter", and "day-day-day". One can call them to you by imitating this call. There are 10 different known calls of tufted titmice. The calls are generally divided into 2 groups. One group is made up of calls that have a very low frequency and the others have a very high frequency. The three calls in the group of high-frequency calls are usually associated with agressive behavior. Tufted titmice also communicate among themselves using body posture and movements.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The average lifespan of tufted titmice is 2.1 years. This number is relatively low because most tufted titmice die as nestlings. Once they reach adulthood, tufted titmice are likely to live for more than 2 years. The longest these birds have been know to live in the wild is 13 years.

Range lifespan

Status: wild:
13 (high) years.

Average lifespan

Status: wild:
2.1 years.

Average lifespan

Status: wild:
159 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan/Longevity

The average lifespan of tufted titmice is 2.1 years. This number is relatively low because most tufted titmice die as nestlings. Once they reach adulthood, tufted titmice are likely to live for more than 2 years. The longest these birds have been know to live in the wild is 13 years.

Range lifespan

Status: wild:
13 (high) years.

Average lifespan

Status: wild:
2.1 years.

Average lifespan

Status: wild:
159 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 13.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeding takes place between March and May. Five to eight brown-speckled, white eggs are layed in nests 3 to 90 feet above the ground. Nests are formed in natural tree cavities, abandoned woodpecker holes, bird boxes, hollow metal pipes, or fence posts. Nests are lined with soft materials such as wool, moss, cotton, leaves, bark, fur, or grass. Tufted Titmice have been known to pluck hairs from live woodchucks, squirrels, opossums, and humans near nest sites. Eggs are incubated by the female for 13 to 17 days, when the nestlings leave the nest cavity.  Tufted titmice are able to breed in the year following their hatching.

Breeding interval: Tufted titmice breed during the warm months of the year, they may have one or two broods each season. The young of the first brood may help care for nestlings of the second brood.

Breeding season: Tufted titmice breed from March to May.

Range eggs per season: 5 to 8.

Range time to hatching: 17 (high) days.

Range fledging age: 17 to 18 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 6.

Both parents feed the young nestlings. In the first 4 days after the young hatch, males feed them much more often than do females. After a while both parents share the job until the young are ready to leave the nest. It is not uncommon for the pair to have nest helpers. These may be their own young or other birds. They assist in feeding the nestlings.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Breeding takes place between March and May. Five to eight brown-speckled white eggs are layed in nests 3-90 feet up. Nests are formed in natural tree cavities, abandoned woodpecker holes, bird boxes, hollow metal pipes, and fence posts and are then filled with wool, moss, cotton, leaves, bark, hair, etc. They even pluck hairs from live woodchucks, squirrels, opossums, and humans near nest sites. Eggs are incubated by the female for 13-17 days, and the young climb down from the cavities when 17-18 days old. Both parents feed the young. There are sometimes two broods a season and the young of the first brood often help care for the second. Tufted titmice are able to breed in the year following their hatching.

Breeding interval: Tufted titmice breed during the warm months of the year, they may have one or two broods each season. The young of the first brood may help care for nestlings of the second brood.

Breeding season: Tufted titmice breed from March to May.

Range eggs per season: 5 to 8.

Range time to hatching: 17 (high) days.

Range fledging age: 17 to 18 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 6.

Both parents feed the young nestlings. In the first 4 days after the young hatch, males feed them much more often than do females. After a while both parents share the job until the young are ready to leave the nest. It is not uncommon for the pair to have nest helpers. These may be their own young or other birds. They assist in feeding the nestlings.

Parental Investment: pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size is 5-8 (commonly 5-6). Sometimes 2 broods per year. Incubation, by female, lasts 12-14 days. Young are tended by both parents (and sometimes young of first brood), leave nest at 15-18 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Baeolophus bicolor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTANTCTTCGGCGCATGAGCCGGAATGGTAGGAACCGCCCTAAGCCTCCTCATCCGTGCAGAACTTGGNCAACCCGGTGCCCTCCTGGGAGACGACCAAATCTACAATGTGGTCGTCACAGCCCACGCCTTTGTAATAATCTTCTTCATAGTCATACCAATCATAATCGGGGGATTTGGAAACTGACTAGTTCCACTGATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCCTTCCCCCCTCCTTCCTTCTCCTACTAGCCTCCTCAACAGTCGAAGCAGGGGCAGGAACAGGATGAACTGTCTACCCACCCCTAGCCGGCAACCTAGCCCACGCCGGAGCATCAGTAGACCTAGCTATCTTCTCCCTTCACTTAGCAGGTATCTCATCAATCCTAGGAGCAATCAACTTCATCACAACCGCTATCAACATAAAACCACCCGCCCTCTCACAATACCAAACTCCACTGTTCGTCTGATCCGTACTAATCACTGCAGTTCTCCTCCTACTCTCCCTTCCAGTCCTCGCAGCCGGCATCACCATGCTCCTCACCGACCGTAACCTGAACACAACCTTCTTCGACCCGGCAGGAGGAGGAGACCCAGTACTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATTCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Baeolophus bicolor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

Tufted titmice ar fairly common throughout the eastern United States.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Tufted titmice ar fairly common throughout the eastern United States.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N3 - Vulnerable

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Restoration Potential: See Mitchell (1988) for specifications for the construction and placement of nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no negative impacts of tufted titmice on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tufted titmice help to control the population of certain insects as well as helping trees by distributing their seeds.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Negative

There are no negative impacts of tufted titmice on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Tufted titmice help to control the population of certain insects as well as helping trees by distributing their seeds.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Tufted Titmouse

The Tufted Titmouse (Baeolophus bicolor) is a small songbird from North America, a species in the tit and chickadee family (Paridae). The Black-crested Titmouse, found from central and southern Texas southwards, was included as a subspecies but is now considered a separate species B. atricristatus.

Tufted titmouse closeup

These birds have grey upperparts and white underparts with a white face, a grey crest, a dark forehead and a short stout bill; they have rust-coloured flanks. The song is usually described as a whistled peter-peter-peter. They make a variety of different sounds, most having a similar tone quality.

The habitat is deciduous and mixed woods as well as gardens, parks and shrubland[2] in the eastern United States; they barely range into southeastern Canada in the Great Lakes region. They are all-year residents in the area effectively circumscribed by the Great Plains, the Great Lakes, the Gulf of Mexico and the Atlantic Ocean. The range is expanding northwards, possibly due to increased availability of winter food at bird feeders. The birds are nowadays resident all year even in rural Ohio where there are few bird feeders, while it was noted around 1905 that many birds from these areas migrated south in winter.[3][2]

They forage actively on branches, sometimes on the ground, mainly eating insects, especially caterpillars, but also seeds, nuts and berries. They will store food for later use. They tend to be curious about their human neighbors and can sometimes be spotted on window ledges peering into the windows to watch what's going on inside. They are more shy when seen at bird feeders; their normal pattern there is to scout the feeder from the cover of trees or bushes, fly to the feeder, take a seed, and fly back to cover to eat it.

Tufted Titmice nest in a hole in a tree, either a natural cavity or sometimes an old woodpecker nest. They line the nest with soft materials, sometimes plucking hair from a live animal such as a dog. If they find shed snake skin, they will try to incorporate pieces of it in their nest.[4] Their eggs are under an inch long and are white or cream-colored with brownish or purplish spots. Sometimes, a bird born the year before remains to help its parents raise the next year's young. The pair may remain together and defend their territory year-round. These birds are permanent residents and often join small mixed flocks in winter. In rare cases, many birds may flock together to rest in a log or tree; some may even suffocate because so many birds are crowded inside of one cavity.

See also

References

  1. ^ BirdLife International (2012). "Baeolophus bicolor". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b Ohio Ornithological Society (2004): Annotated Ohio state checklist
  3. ^ Henninger, W.F. (1906). "A preliminary list of the birds of Seneca County, Ohio". Wilson Bull. 18 (2): 47–60. 
  4. ^ Medlin, E.C. & Risch, T.S. (2006). "An experimental test of snake skin use to deter nest predation". Condor 108 (4): 963–965. doi:10.1650/0010-5422(2006)108[963:AETOSS]2.0.CO;2.  Summary at conservationevidence.com
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly in genus Parus; transferred to Baeolophus by AOU (1997). Formerly considered conspecific with B. ATRICRISTATUS (Black-crested Titmouse; AOU 1998), but recognized as a separate species by Banks et al. (2002). These two taxa hybridize freely in a stable, narrow zone through east-central Texas (Dixon 1955, 1989, 1990), but they are distinct genetically (Braun et al. 1984, Avise and Zink 1988, Sheldon et al. 1992) and vocally (Dixon 1955, Coldren 1992). Sibley and Monroe (1990) treated Bicolor and ATRICRISTATUS as separate species. Gill and Slikas (1992) characterized Bicolor and ATRICRISTATUS as hybridizing semispecies. See Sheldon et al. (1992) for DNA-DNA hybridization evidence of phylogenetic relationships among major lineages of Parus.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!