Articles on this page are available in 1 other language: Dutch (1) (learn more)

Overview

Brief Summary

Instead of singing, great spotted woodpeckers drum against dead trees, telephone poles and even metal chimney pipes. They can't sing well at all. They are commonly found in woods, gardens and parks where they search for lots of insects and tree seeds. Sometimes, you find a woodpecker forge in a pine trunk: this is a collection of pine or spruce cones. The woodpecker clinches cones filled with seeds firmly in the wood. It plucks out all of the seeds and replaces the cone with a fresh one. All of the empty cones lie under the forge on the ground.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Copyright Ecomare

Source: Ecomare

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Biology

The great spotted woodpecker feeds on seeds, invertebrates, and occasionally bird eggs and nestlings (2). It often extracts seeds from kernels by wedging them in crevices in tree bark, which act as 'anvils'; a pile of cones often builds up under these anvils, betraying their presence (2). Drumming, which acts as a territorial defence, is carried out by both sexes, usually in March and April (3). After a courtship display, both sexes help to excavate the nest in a tree (3). The chamber is typically 30 cm deep, and the oval-shaped entrance hole is around 4 m from the ground (3). From mid-May to early June between 4 and 7 white eggs are laid; the female incubates them for 16 days, after which time both parents feed the young for 18-21 days. Just one brood is produced a year (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

The great spotted woodpecker is the most common and widespread of the British woodpeckers (3). It has black and white plumage, a prominent oval-shaped white patch on each wing, a red patch under the tail; males also have a red patch on the rear of the head (2). Juveniles can be identified by their red crown (2). The main call is a sharp 'kick', which may be repeated. During spring, it can be heard drumming; this sound is produced by beating the bill on a dead branch (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

This woodpecker is most common in southern England, although it is absent from the fens of East Anglia and from higher ground. It has a patchier distribution in Wales, southwest England and Scotland (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Found in both broadleaved and coniferous woodlands and forests, and more recently has begun to exploit gardens and parks (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12.7 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dendrocopos major

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 10 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAAGACATTGGCACTCTATATCTCATCTTCGGCGCATGAGCTGGCATAATTGGCACAGCCCTCAGCCTCCTCATTCGAGCAGAACTGGGCCAACCCGGCACCCTCCTTGGCGACGACCAAATCTACAATGTCATTGTCACCGCCCATGCATTTGTAATAATTTTCTTCATAGTAATACCCATCATAATTGGGGGATTTGGAAACTGACTCGTACCCCTCATAATCGGTGCACCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTTCTCCCCCCCTCATTCCTTCTTCTCCTAGCCTCCTCCACAGTAGAAGCAGGGGCCGGAACAGGATGAACGGTTTACCCGCCTCTTGCCGGCAACTTAGCCCACGCAGGGGCCTCAGTAGACCTAGCCATCTTTTCACTCCACCTAGCGGGCATCTCATCAATCCTAGGAGCAATCAACTTCATCACAACAGCTATCAACATAAAACCCCCAGCCATCTCACAATACCAAACCCCCCTATTCGTCTGATCTGTCCTTATCACCGCTGTCCTCCTACTCCTATCACTTCCAGTACTCGCTGCCGGTATTACAATACTTCTCACAGACCGCAACCTGAACACTACATTCTTTGACCCCGCCGGAGGAGGCGACCCCATCCTCTACCAACATCTCTTCTGATTCTTTGGACACCCCGAAGTCTATATCCTCATTCTTCCAGGATTTGGAATT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Dendrocopos major

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 27
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Widespread and common species. Protected at all times under the Wildlife & Countryside Act 1981 (6) and included in the Birds of Conservation Concern Green List (low conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 12000000-18000000 breeding pairs, equating to 36000000-54000000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 73500000-216000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Not currently threatened (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

No specific conservation action has been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Spotted Woodpecker

The Great Spotted Woodpecker (or Greater Spotted Woodpecker), Dendrocopos major, is a bird species of the woodpecker family (Picidae). It is distributed throughout Europe and northern Asia, and usually resident year-round except in the colder parts of its range. It is not considered a threatened species by the IUCN, being widely distributed and quite common.[2] A significant recent increase in the British population has been suggested as the cause of the recolonisation of Ireland.

Contents

Description [edit]

The Great Spotted Woodpecker is 23–26 centimetres (9.1–10 in) long, with a 38–44 centimetres (15–17 in) wingspan. The upperparts are glossy black, with white on the sides of the face and neck. A black line zigzags from the shoulder halfway across the breast (in some subspecies nearly meeting in the center), then back to the nape; a black stripe, extending from the bill, runs below the eye to meet this latter part of the zigzag line. On the shoulder is a large white patch and the flight feathers are barred with black and white. The three outer tail feathers are barred; these show when the short stiff tail is outspread, acting as a support in climbing. The underparts are dull white, the abdomen and undertail coverts crimson. The bill is slate black and the legs greenish grey.

Males have a crimson spot on the nape, which is absent in females and juvenile birds. In the latter, the top of the head is crimson between the bill and the center of the crown instead.

Despite its contrasting plumage, the Great Spotted Woodpecker is often an inconspicuous bird. The large white shoulder patch is the feature that most easily catches the eye. When hidden by the foliage, its presence is often advertised by the mechanical drumming, a vibrating rattle, produced by the rapidly repeated blows of its strong bill upon a trunk or branch. The drumming of this species is shorter than that of the Lesser Spotted Woodpecker, and fades away at the end. It is audible from a great distance, depending on the wind and the condition of the wood, a hollow bough naturally producing a louder note than living wood. The call is a sharp kik, kik.

The Great Spotted Woodpecker has several living subspecies. The paleosubspecies D. m. submajor lived during the Middle Pleistocene Riss glaciation (250,000 to 300,000 years ago); it was found in Europe south of the ice sheet. It is sometimes treated as a distinct species, but did not differ from the living Great Spotted Woodpecker of Europe except in size; the European subspecies of our time are probably its direct descendants. [3]

Similar species [edit]

The male Great Spotted Woodpecker is almost unmistakable. The only species that are quite similar are the Syrian Woodpecker (D. syriacus) and the White-winged Woodpecker (D. leucopterus). The former differs in the less well-developed zigzag stripe on the neck, which neither reaches as far towards the center of the breast nor meets the black of the nape as it does in Great Spotted Woodpeckers. The latter has a far more extensive white wing patch.

Females can be distinguished from female Syrian Woodpeckers and White-winged Woodpeckers in the same way as males; the female Sind Woodpecker (D. assimilis) also looks similar but does not have the zigzag stripe reaching the nape. Great Spotted Woodpecker females can also be confused with a female White-backed Woodpecker (D. leucotos). However, the latter species lacks the white shoulder patch, having an all-white lower back instead; it also has a less well-developed zigzag stripe on the neck, just like the Syrian Woodpecker. The female Himalayan Woodpecker (D. himalayensis) is also similar, but it can be distinguished by the same characteristics as the female Syrian Woodpecker.

Immature birds resemble the Middle Spotted Woodpecker (D. medius), the male White-backed Woodpecker, the immature Syrian and White-winged Woodpeckers, and male or immature Lesser Spotted Woodpeckers (Picoides minor, formerly also in Dendrocopos). The first of these species has only an angular cheek spot instead of the zigzag stripe, while the White-backed and Lesser Spotted Woodpeckers lack the white shoulder patch and have a less well-developed zigzag stripe, as described above. The Lesser Spotted Woodpecker also has no red on the abdomen. White-backed Woodpeckers are also larger, while Lesser Spotted Woodpeckers are smaller than immature Great Spotted Woodpeckers. Differences from Syrian and White-winged Woodpeckers are the same as for adults.

The species has recently recolonized Ireland, where it apparently became extinct in the seventeenth century;[4] in 2011 there were an estimated 50 breeding pairs, concentrated mainly in Wicklow and Down.

Ecology [edit]

Female foraging for grubs in England
Female in England
Woodpecker feeding hole.

It is an inhabitant of woodlands and parks, depending for food and nesting sites upon old trees. Its actions are jerky, and it hops rather than climbs, leaping forward with one foot just in advance of the other. When a space is crossed the flight is easy and undulating.

The food mainly consists of insects and grubs but also seeds, fruit, scraps, eggs, chicks and small rodents. The woodpecker usually alights on the trunk, working upwards, from side to side, but sometimes will perch in passerine style, when it sits well upright. During the ascent it taps the bark, breaking off fragments, but often extracts its prey from crevices with the tip of its sticky tongue. Beechmast, acorns, nuts and berries are eaten when animal food is scarce.

The nesting hole, neat and round, is bored in soft or decaying wood horizontally for a few inches, then perpendicularly down. At the bottom of a shaft, usually from six to twelve inches in depth, a small chamber is excavated and lined with wood chips. This woodpecker shows no marked preference for particular tree taxa, building its nest in gymnosperms and angiosperms alike.

In Japanese forests for example, nests were observed in Fagales (Grey Alder, Alnus hirsuta ssp. incana; Japanese White Birch, Betula platyphylla; Japanese Hop-hornbeam, Ostrya japonica), Lamiales (Japanese Tree Lilac, Syringa reticulata), Malvales (Japanese Lime, Tilia japonica), Malpighiales (willows, Salix sp.), Pinales (Japanese Larch, Larix kaempferi), Rosales (Sargent's Cherry, Prunus sargentii) and Sapindales (Usugumo Maple, Acer pictum subsp. mono– Painted Maple). Mongolian Oak (Quercus mongolica, Fagales) and Prickly Castor-oil Tree (Kalopanax pictus, Apiales) were rarely if ever used for nesting however.[5]

Nesting trees chosen by this woodpecker almost invariably have soft heartwood and tough sapwood, often due to parasites or diseases that weaken the heartwood only. It is unknown how D. major finds suitable trees, though it is entirely possible that they do so by drumming, making use of the different speed of sound in materials with differing elastic modulus and density. Tree species that are rarely or never used for nesting might simply not have wood with the required properties.[5]

The creamy-white eggs, five to seven in number, are laid in the second half of May. The young cluster at the mouth of the hole and keep a continuous chatter when the parents are feeding them, but when alarmed slip back into the hole. The nest hole is rarely used again, but not infrequently other holes are bored in the same tree.

Distribution [edit]

In Ireland, this woodpecker has been recorded in Tollymore Forest Park, County Down,[6] Tomnafinnoge Woods in County Wicklow, Gorey in County Wexford, and in Cabinteely and the Phoenix Park in Dublin. While the Irish Wildlife Trust had argued in the past for the reintroduction of this woodpecker, the birds themselves began to recolonise Ireland of their own accord since about 2007.[7]

Woodpecker making hole in plaster

Footnotes [edit]

  1. ^ BirdLife International (2012). "Dendrocopos major". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ BLI (2008)
  3. ^ Mlíkovský (2002): p.150, Mourer-Chauviré et al. (2003)
  4. ^ D'Arcy, Gordon Ireland's Lost Birds Four Courts Press 1999 pp.113-4
  5. ^ a b Matsuoka (2008)
  6. ^ McComb, A.M.G., Kernohan, R., Mawhirt, P. Robinson, B. Weir, J and Wells, B. 2010. Great spotted woodpecker (Dendrocopos major'): proof of breeding in Tollymore Forest Park, Co. Down. Ir Nat. J. 31:66 - 67
  7. ^ Reintroducing the boar: a wild notion? Irish Times, 2012-01-14.

References [edit]

Great spotted woodpecker by Carl Friedrich Deiker (1875)
  • Gorman, Gerard (2004): Woodpeckers of Europe: A Study of the European Picidae. Bruce Coleman, UK. ISBN 1-872842-05-4
  • Matsuoka, Shigeru (2008): Wood hardness in nest trees of the Great Spotted Woodpecker Dendrocopos major. Ornithological Science 7(1): 59–66. DOI:10.2326/1347-0558(2008)7[59:WHINTO]2.0.CO;2 HTML abstract
  • Mlíkovský, Jirí (2002): Cenozoic Birds of the World (Part 1: Europe). Ninox Press, Prague. ISBN 80-901105-3-8 PDF fulltext
  • Mourer-Chauviré, C.; Philippe, M.; Quinif, Y.; Chaline, J.; Debard, E.; Guérin, C. & Hugueney, M. (2003): Position of the palaeontological site Aven I des Abîmes de La Fage, at Noailles (Corrèze, France), in the European Pleistocene chronology. Boreas 32: 521–531. doi:10.1080/03009480310003405 (HTML abstract)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!