Articles on this page are available in 1 other language: Spanish (18) (learn more)

Overview

Distribution

Range

Venezuela, the Guianas and adjacent n Brazil; Trinidad.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trogon violaceus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAATCGATGATTATTTTCAACTAATCACAAAGACATCGGCACACTATACCTAATCTTCGGAGCATGGGCTGGCATGATTGGTACCTCCCTAAGCCTGCTCATCCGCGCAGAACTAGGCCAACCCGGAACCCTTCTAGGAGATGACCAAATTTACAACGTTATCGTTACCGCCCATGCTTTTGTCATGATCTTCTTTATGGTTATGCCAATTATAATCGGAGGCTTTGGAAACTGATTAGTTCCACTTATAATTGGTGCCCCAGACATAGCCTTCCCACGTATAAATAACATGAGCTTCTGACTACTTCCCCCATCCTTCCTACTTCTACTAGCCTCTTCCACAGTAGAAGCCGGGGCAGGAACAGGATGAACCGTATATCCACCCCTTGCCGGCAACCTAGCCCATGCTGGTGCTTCAGTAGACATGGCCATCTTCTCTCTCCACCTAGCAGGTGTGTCCTCCATTCTAGGGGCAATTAACTTCATTACGACAGCCATCAACATAAAACCCCCAGCCCTATCCCAATACCAAACCCCACTATTCGTTTGATCAGTCCTTATCACCGCAGTCCTTCTCCTACTCTCACTCCCTGTCCTAGCTGCAGGAATCACAATACTCCTAACAGACCGAAATCTAAACACTACCTTCTTTGACCCAGCAGGAGGAGGTGACCCTATTCTCTATCAGCACCTATTCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Trogon violaceus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2013

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The population size has not been quantified, but the species has been described as 'local' (del Hoyo et al. 2001).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Violaceous Trogon

The Violaceous Trogon (Trogon violaceus), also known as the Guianan Trogon, is a near passerine bird in the trogon family, Trogonidae. It is found in humid forests in the Amazon Basin of South America and on the island of Trinidad, although some authorities have argued for treating the west Amazonian population as a separate species, the Amazonian Trogon (T. ramonianus). Until recently, the Gartered Trogon (T. caligatus) of Mexico, Central America and north-western South America was generally considered a subspecies of the Violaceous Trogon.

Behavior[edit]

It is a resident of moist tropical forests, where it nests in a wasp, ant or termite nest or a hole in a rotten tree, with a typical clutch of two or three white eggs.

Violaceous Trogons feed on insects and small fruit, and their broad bills and weak legs reflect their diet and arboreal habits. Although their flight is fast, they are reluctant to fly any distance. They typically perch upright and motionless.

Description[edit]

Female in Panama

Trogons have distinctive male and female plumages, with soft, often colourful, feathers. This relatively small species is about 23 centimetres (9.1 in) long and weighs 56 grams (2.0 oz). The head and upper breast of the male are blue and the back is green, becoming bluer on the rump. A faint white line separates the breast from the orange yellow underparts. The undertail is white with black barring, and the wings are black, vermiculated with white. The complete eye-ring is yellow. The female Violaceous Trogon resembles the male, but has a dark grey back, head and breast, and an incomplete white eye-ring.

This species resembles the White-tailed Trogon, but the latter is larger and has a complete pale blue eye-ring in both sexes. Furthermore, the male White-tailed Trogon lacks barring to the undertail.

The shade of the blue of the head in the male differs between the Violaceous Trogon and the Gartered Trogon, but (disregarding their separate distributions) the call is the main distinction between the two. The Gartered has a slurred whistled cuh-cuh-cuh, and Violaceous has a soft cow cow, cow.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!