Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trogon curucui

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTAATCGATGATTATTTTCAACTAACCACAAAGACATCGGCACACTATACCTAATCTTCGGAGCATGGGCTGGCATGATTGGCACATCCCTAAGCCTGCTCATCCGCGCAGAACTAGGTCAACCCGGAACCCTTCTAGGGGATGACCAAATTTACAACGTTATCGTTACCGCCCATGCTTTTGTCATAATCTTCTTTATGGTTATGCCAATTATAATCGGAGGCTTTGGAAACTGATTAGTTCCACTTATAATTGGTGCCCCAGACATAGCCTTCCCACGTATAAATAACATGAGCTTCTGACTACTTCCCCCATCCTTCCTACTTCTACTAGCCTCTTCCACAGTAGAAGCTGGGGCAGGAACAGGATGAACCGTTTATCCACCTCTTGCCGGCAACCTAGCCCATGCTGGTGCTTCAGTAGACATAGCCATCTTCTCTCTCCACCTGGCAGGTGTCTCCTCCATTCTGGGGGCAATTAACTTCATTACGACAGCCATCAACATAAAACCCCCAGCCCTATCCCAGTACCAAACCCCACTATTCGTCTGATCGGTTCTTATCACCGCAGTTCTTCTCCTCCTCTCACTCCCTGTCCTAGCTGCAGGAATCACAATACTCTTAACAGACCGAAATCTGAATACTACCTTCTTCGACCCAGCAGGAGGGGGTGACCCCATTCTCTATCAGCACCTGTTCTGATTTTTTGGACACCCAGAAGTCTATATTCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trogon curucui

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue-crowned Trogon

The Blue-crowned Trogon (Trogon curucui) is a species of bird in the Trogonidae family. It is found in Argentina, Bolivia, Brazil, Colombia, Ecuador, Paraguay, and Peru. Its natural habitats are subtropical or tropical moist lowland forests and heavily degraded former forest.

Illustration by Keulemans, 1892

Range in South America, Amazon Basin

The Blue-crowned Trogon's range in South America is the southwestern and southeastern quadrants of the Amazon Basin with the northern limit being the Amazon River. The range continues beyond the Amazon Basin south to northern Argentina and Paraguay, and eastwards to eastern coastal Brazil as far south as northern Espírito Santo state; a third of the species range is outside the Amazon Basin.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!