Articles on this page are available in 1 other language: Spanish (19) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Trogon massena

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTATACCTAATCTTTGGAGCATGAGCCGGCATAATCGGCACCTCTCTTAGCCTACTTATTCGCGCAGAACTAGGTCAACCTGGAACCCTCCTAGGAGATGACCAAATTTATAACGTCATCGTTACCGCCCATGCTTTCGTCATAATCTTCTTTATAGTTATACCAATTATAATCGGGGGCTTCGGAAACTGACTAGTCCCACTTATAATCGGCGCTCCCGACATAGCCTTTCCACGTATAAACAACATGAGCTTCTGACTACTCCCTCCATCCTTCCTACTCCTACTAGCTTCTTCCACAGTAGAAGCCGGAGCAGGGACAGGATGAACTGTATACCCTCCTCTCGCTGGCAACCTAGCCCATGCCGGCGCCTCAGTAGACCTAGCCATCTTCTCCCTTCACCTAGCAGGCGTATCCTCTATTCTAGGTGCAATTAACTTTATTACTACAGCCATCAACATAAAACCCCCAGCCCTATCCCAATATCAAACCCCATTATTTGTCTGATCAGTTCTCATCACTGCAGTTCTCCTCCTTCTCTCCCTCCCCGTACTAGCTGCAGGCATTACAATACTCCTAACGGACCGAAACCTAAATACCACTTTCTTTGACCCAGCAGGAGGAGGTGACCCTATCTTATACCAACACCTGTTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Trogon massena

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimated the population to number <50,000 individuals (A. Panjabi in litt. 2008), which is placed in the band 20,000-49,999 individuals here.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Slaty-tailed Trogon

The Slaty-tailed Trogon, Trogon massena, is a near passerine bird in the trogon family, Trogonidae. It breeds in lowlands from southeastern Mexico south through Central America, to Colombia, and a small region of northwestern Ecuador.

It is a resident of the canopy and higher levels of damp tropical forests, but comes lower in adjacent semi-open areas. It nests 3 to 15 m high in an occupied termite nest or decaying tree trunk, with a typical clutch of three white or bluish-white eggs laid in a chamber reached by an ascending tunnel. Both sexes excavate the nesting chamber.

Slaty-tailed Trogons feed on insects and fruit, and their broad bills and weak legs reflect their diet and arboreal habits. Although their flight is fast, they are reluctant to fly any distance. They typically perch upright and motionless.

Trogons have distinctive male and female plumages, with soft, often colourful, feathers. This species is about 30 cm long and weighs 145 g. It has a uniformly dark grey tail, and the wing coverts also appear grey, although actually finely vermiculated in black and white. The male Slaty-tailed Trogon has a green back, head and breast, red belly and orange bill. The female has a dark grey back, head and breast, red belly and only partially orange bill, most of the upper mandible being black. The call is a nasal uk uk uk.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!