Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

Range Description

Tinamus major has a wide distribution within the Neotropics, with 12 recognised subspecies. Subspecies robustus occurs in south-east Mexico, east Guatemala and Honduras, overlapping with percautus, also occuring in south-east Mexico as well as north Guatemala and Belize. Subspecies fuscipennis ranges from north Nicaragua through Costa Rica to west Panama, overlapping with castaneiceps which occurs in south-west Costa Rica and west Panama. Subspecies brunneiventris is endemic to south-central Panama. Subspecies saturatus occurs in east Panama and north-west Colombia. Subspecies latifrons is distributed in south-west Colombia and west Ecuador, where it is uncommon to rare (del Hoyo et al. 1992, Restall et al. 2006). Subspecies zuliensis occurs in north-east Colombia and north Venezuela. Subspecies peruvianus ranges from south-east Colombia and east Ecuador through Peru to north-east Bolivia and extreme west Brazil. Subspecies serratus is endemic to north-west Brazil. The nominate subspecies major ranges from east Venezuela through Guyana, Suriname and French Guiana to north-east Brazil (del Hoyo et al. 1992); this taxon is abundant where forest is intact (Restall et al. 2006). Subspecies olivascens occurs in Amazonian Brazil (del Hoyo et al. 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
The species occurs in dense rainforest of both "terra firme" (no flooding) and "várzea" (seasonally-flooded) types, up to 1,500 m. It feeds on the forest floor, predominantly on berries, fruits and seeds, but will also take nuts and small animals. Breeding is generally between January and July, but perhaps all year round in Suriname where it has been recorded breeding in September. The nest is made between the buttress roots of large trees (del Hoyo et al. 1992).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tinamus major

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTTACCACTCGATGATTATTCTCAACAAACCACAAAGACATCGGCACACTATACTTAATCTTTGGTGCATGAGCAGGTATAGTAGGTACAGCCCTTAGCCTGCTTATTCGTGCTGAACTTGGTCAACCAGGTACTCTATTAGGGGATGACCAAATTTACAACGTCATCGTAACAGCCCATGCCTTCGTTATAATTTTCTTCATAGTTATACCCGTAATAATCGGGGGCTTTGGAAACTGATTAGTCCCACTTATAATTGGAGCTCCTGACATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGGCTCCTACCACCATCATTCCTACTTCTACTAGCTTCCTCTACCATTGAAGCTGGAGCGGGTACTGGATGAACCGTTTACCCCCCACTAGCTGGAAATATAGCCCATGCAGGCCCCTCTGTAGATCTAGCTATCTTCTCCCTACATCTTGCTGGGGTATCCTCTATTCTCGGAGCAATCAACTTTATTACTACAGCCATCAACATAAAACCGCCTGCCCTATCTCAATACCAAACCCCACTATTCGTATGATCTGTCCTAATCACTGCCATCCTTTTACTACTATCCCTTCCAGTGCTTGCTGCTGGTATTACCATACTCCTCACTGACCGAAACCTTAATACCTCATTCTTTGACCCAGCAGGAGGAGGAGATCCCATTCTATATCAACACCTATTCTGATTTTTTGGGCACCCAGAAGTTTACATCCTCATTCTCCCAGGATTCGGAATTATCTCCCATGTAGTCGCCTACTATGCTGGAAAAAAAGAACCATTCGGATATATAGGAATAGTCTGAGCAATATTATCTATTGGATTCCTAGGCTTCATCGTCTGAGCCCATCACATATTTACAGTTGGAATAGATGTTGATACACGAGCTTACTTCACATCTGCCACCATAATCATCGCCATTCCCACTGGTATTAAAGTCTTCAGCTGATTAGCCACTCTTCACGGAGGCACCATCAAATGAGACCCACCCATCCTATGAGCCTTAGGCTTTATCTTCCTCTTTACCATTGGTGGCCTCACCGGTATTGTACTAGCTAATTCCTCACTCGACATCGCTCTCCACGATACTTATTATGTAGTCGCACACTTCCACTATGTCTTATCCATAGGGGCTGTATTTGCTATCCTAGCTGGATTTACACACTGATTCCCCCTATTTACCGGATTTACCCTACACCCAACTTGAGCAAAAGCCCACTTCGGAGTTATATTTACAGGAGTAAACCTAACCTTTTTCCCACAGCATTTCCTAGGACTAGCTGGAATACCACGGCGATATTCTGACTACCCAGATGCCTACACCATTTGAAATACTGTGTCCTCTATTGGTTCTCTAATCTCCATAACTGCTGTCATTATACTCATATTCATTATCTGAGAAGCATTTTCTTCCAAACGAAAAATCCAACAACCTGAACTAACCTCTACAAATATTGAATGAATCCACGGTTGTCCACCCCCACACCACACCTTTGAAGAGCCAGCTTATGTTCAAGTCCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Tinamus major

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Lees, A. & Panjabi, A.

Justification

Based on a model of future deforestation in the Amazon basin, and the species’s susceptibility to habitat fragmentation and hunting, it is suspected that its population will decline by 25-30% over the next three generations, and it has therefore been uplisted to Near Threatened.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species's main threat comes from habitat loss across its large range, in particulr accelerating deforestation in Amazonia: despite its large range it is predicted to lose over 15% of its available habitat in the next three generations (Soares-Filho et al. 2006, Bird et al. 2011). It is likely to be sensitive to degradation (A. Lees in litt. 2011) especially given its preference for tall, undisturbed forest. In addition to this it is prized as a dish (del Hoyo et al. 1992) and heavily hunted (A. Lees in litt. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Conservation Actions Underway
None is known.

Conservation Actions Proposed

Expand the protected area network to effectively protect IBAs. Effectively resource and manage existing and new protected areas, utilising emerging opportunities to finance protected area management with the joint aims of reducing carbon emissions and maximizing biodiversity conservation. Conservation on private lands, through expanding market pressures for sound land management and preventing forest clearance on lands unsuitable for agriculture, is also essential (Soares-Filho et al. 2006).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great tinamou

The great tinamou (Tinamus major) also called mountain hen[4] is a species of tinamou ground bird native to Central and South America. There are several subspecies, mostly differentiated by their coloration.

Description[edit]

Great tinamou are approximately 44 cm (17 in) long, 1.1 kg (2.4 lb) in weight and size and shape of a small turkey. It ranges from light to dark olive-green in color with a whitish throat and belly,[4] flanks barred black, and undertail cinnamon. Crown and neck rufous, occipital crest and supercilium blackish. Its legs are blue-grey in color. All these features enable great tinamou to be well-camouflaged in the rainforest understory.

The great tinamou has a distinctive call, three short, tremulous, but powerful piping notes which can be heard in its rainforest habitat in the early evenings.[4]

Subspecies T. m. castaneiceps

Taxonomy[edit]

All tinamous are from the family Tinamidae, and are the closest living relatives of the ratites. Unlike ratites, tinamous can fly, although in general, they are not strong fliers. All ratites evolved from prehistoric flying birds.[4]

There are twelve sub-species

Johann Friedrich Gmelin identified the great tinamou from a specimen located in Cayenne, French Guyana, in 1789.[4]

Mating[edit]

The picture at the right is a polygynandrous species, and one that features exclusive male parental care. A female will mate with a male and lay an average of four eggs which he then incubates until hatching. He cares for the chicks for approximately 3 weeks before moving on to find another female. Meanwhile, the female has left clutches of eggs with other males. She may start nests with five or six males during each breeding season, leaving all parental care to the males. The breeding season is long, lasting from mid-winter to late summer. The eggs are large, shiny, and bright blue or violet in color, and the nests are usually rudimentary scrapings in the buttress roots of trees.[4]

Except during mating, when a pair stay together until the eggs are laid, great tinamous are solitary and roam the dark understory alone, seeking seeds, fruit, and small animals such as insects, spiders, frogs and small lizards in the leaf litter. They are especially fond of Lauraceae, annonaceae, myrtaceae, sapotaceae.[4]

A nest of eggs.

Habitat[edit]

Great tinamou lives in subtropical and tropical forest such as rainforest, lowland evergreen forest, river-edge forest,[3] swamp forest and cloud forest at altitudes from 300–1,500 m (1,000–4,900 ft). Unlike some other tinamous, the great tinamou isn't as affected by forest fragmentation.[1] Its nest can be found at the base of a tree.

Conservation[edit]

This species is widespread throughout its large range (6,600,000 km2 (2,500,000 sq mi)),[6] and it was evaluated as Least Concern on the IUCN Red List of Threatened Species.[1] They are hunted with no major effect on their population.[4] In 2012 the species was reclassified as Near Threatened.[7]

Footnotes[edit]

  1. ^ a b c BirdLife International (2012). "Tinamus major". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m Brands, S. (2008)
  3. ^ a b American Ornithologists' Union (1998)
  4. ^ a b c d e f g h Davies, S. J. J. F. (2003)
  5. ^ a b c d e f g h i j k l Clements, J (2007)
  6. ^ BirdLife International (2008)
  7. ^ "Recently recategorised species". Birdlife International. Retrieved 9 June 2012. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!