Articles on this page are available in 1 other language: Spanish (9) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Tinamus major

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTTACCACTCGATGATTATTCTCAACAAACCACAAAGACATCGGCACACTATACTTAATCTTTGGTGCATGAGCAGGTATAGTAGGTACAGCCCTTAGCCTGCTTATTCGTGCTGAACTTGGTCAACCAGGTACTCTATTAGGGGATGACCAAATTTACAACGTCATCGTAACAGCCCATGCCTTCGTTATAATTTTCTTCATAGTTATACCCGTAATAATCGGGGGCTTTGGAAACTGATTAGTCCCACTTATAATTGGAGCTCCTGACATAGCTTTCCCTCGAATAAACAACATAAGCTTCTGGCTCCTACCACCATCATTCCTACTTCTACTAGCTTCCTCTACCATTGAAGCTGGAGCGGGTACTGGATGAACCGTTTACCCCCCACTAGCTGGAAATATAGCCCATGCAGGCCCCTCTGTAGATCTAGCTATCTTCTCCCTACATCTTGCTGGGGTATCCTCTATTCTCGGAGCAATCAACTTTATTACTACAGCCATCAACATAAAACCGCCTGCCCTATCTCAATACCAAACCCCACTATTCGTATGATCTGTCCTAATCACTGCCATCCTTTTACTACTATCCCTTCCAGTGCTTGCTGCTGGTATTACCATACTCCTCACTGACCGAAACCTTAATACCTCATTCTTTGACCCAGCAGGAGGAGGAGATCCCATTCTATATCAACACCTATTCTGATTTTTTGGGCACCCAGAAGTTTACATCCTCATTCTCCCAGGATTCGGAATTATCTCCCATGTAGTCGCCTACTATGCTGGAAAAAAAGAACCATTCGGATATATAGGAATAGTCTGAGCAATATTATCTATTGGATTCCTAGGCTTCATCGTCTGAGCCCATCACATATTTACAGTTGGAATAGATGTTGATACACGAGCTTACTTCACATCTGCCACCATAATCATCGCCATTCCCACTGGTATTAAAGTCTTCAGCTGATTAGCCACTCTTCACGGAGGCACCATCAAATGAGACCCACCCATCCTATGAGCCTTAGGCTTTATCTTCCTCTTTACCATTGGTGGCCTCACCGGTATTGTACTAGCTAATTCCTCACTCGACATCGCTCTCCACGATACTTATTATGTAGTCGCACACTTCCACTATGTCTTATCCATAGGGGCTGTATTTGCTATCCTAGCTGGATTTACACACTGATTCCCCCTATTTACCGGATTTACCCTACACCCAACTTGAGCAAAAGCCCACTTCGGAGTTATATTTACAGGAGTAAACCTAACCTTTTTCCCACAGCATTTCCTAGGACTAGCTGGAATACCACGGCGATATTCTGACTACCCAGATGCCTACACCATTTGAAATACTGTGTCCTCTATTGGTTCTCTAATCTCCATAACTGCTGTCATTATACTCATATTCATTATCTGAGAAGCATTTTCTTCCAAACGAAAAATCCAACAACCTGAACTAACCTCTACAAATATTGAATGAATCCACGGTTGTCCACCCCCACACCACACCTTTGAAGAGCCAGCTTATGTTCAAGTCCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Tinamus major

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Great Tinamou

The Great Tinamou (Tinamus major) also called Mountain hen[4] is a species of tinamou ground bird native to Central and South America. There are several subspecies, mostly differentiated by their coloration:

Contents

Description

Great Tinamou are approximately 44 cm (17 in) long, 1.1 kg (2.4 lb) in weight and size and shape of a small turkey. It ranges from light to dark olive-green in color with a whitish throat and belly,[4] flanks barred black, and undertail cinnamon. Crown and neck rufous, occipital crest and supercilium blackish. Its legs are blue-grey in color. All these features enable Great Tinamou to be well-camouflaged in the rainforest understory.

The Great Tinamou has a distinctive call, three short, tremulous, but powerful piping notes which can be heard in its rainforest habitat in the early evenings.[4]

Subspecies T. m. castaneiceps

Taxonomy

All tinamous are from the family Tinamidae, and are the closest living relatives of the ratites. Unlike ratites, tinamous can fly, although in general, they are not strong fliers. All ratites evolved from prehistoric flying birds.[4]

There are twelve sub-species

Johann Friedrich Gmelin identified the Great Tinamou from a specimen located in Cayenne, French Guyana, in 1789.[4]

Mating

The picture at the right is a polygynandrous species, and one that features exclusive male parental care. A female will mate with a male and lay an average of four eggs which he then incubates until hatching. He cares for the chicks for approximately 3 weeks before moving on to find another female. Meanwhile, the female has left clutches of eggs with other males. She may start nests with five or six males during each breeding season, leaving all parental care to the males. The breeding season is long, lasting from mid-winter to late summer. The eggs are large, shiny, and bright blue or violet in color, and the nests are usually rudimentary scrapings in the buttress roots of trees.[4]

Except during mating, when a pair stay together until the eggs are laid, Great Tinamous are solitary and roam the dark understory alone, seeking seeds, fruit, and small animals such as insects, spiders, frogs and small lizards in the leaf litter. They are especially fond of Lauraceae, annonaceae, myrtaceae, sapotaceae.[4]

A nest of eggs.

Habitat

Great Tinamou lives in subtropical and tropical forest such as rainforest, lowland evergreen forest, river-edge forest,[3] swamp forest and cloud forest at altitudes from 300–1,500 m (1,000–4,900 ft). Unlike some other tinamous, the great tinamou isn't as affected by forest fragmentation.[1] Its nest can be found at the base of a tree.

Conservation

This species is widespread throughout its large range (6,600,000 km2 (2,500,000 sq mi)),[6] and it was evaluated as Least Concern on the IUCN Red List of Threatened Species.[1] They are hunted with no major effect on their population.[4] In 2012 the species was reclassified as Near Threatened.[7]

Footnotes

  1. ^ a b c BirdLife International (2012). "Tinamus major". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/100060014. Retrieved 16 July 2012.
  2. ^ a b c d e f g h i j k l m Brands, S. (2008)
  3. ^ a b American Ornithologists' Union (1998)
  4. ^ a b c d e f g h Davies, S. J. J. F. (2003)
  5. ^ a b c d e f g h i j k l Clements, J (2007)
  6. ^ BirdLife International (2008)
  7. ^ "Recently recategorised species". Birdlife International. http://www.birdlife.org/action/science/species/global_species_programme/whats_new.html. Retrieved 9 June 2012.

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!