Overview

Brief Summary

Biology

The greater rhea feeds mainly on plant matter, including leaves, roots, seeds and fruits. It also takes insects and small animals, such as lizards, frogs, small birds and even snakes, and sometimes catches flies that have gathered around carrion. The greater rhea also commonly swallows pebbles, which help to grind down food in the gizzard, and can often be seen feeding alongside herds of pampas deer, guanacos, vicunas, or domestic livestock (2) (6). Rheas are good runners, capable of reaching speeds of over 60 kilometres an hour, and, perhaps surprisingly, are also good swimmers (2). Outside of the breeding season, the greater rhea lives in mixed flocks of up to 30 or more individuals, though old males are often solitary (2) (6) (9). However, at the start of the breeding season, from August to January, breeding females separate into small groups. At the same time, the males become territorial, competing for territories with threats or fights, intertwining necks and biting or kicking at rival males (2) (6) (12). A successful male attempts to attract a group of females into the territory, performing an elaborate courtship display that involves calling, running around the females with feathers ruffled and wings spread, and then standing beside the females with the neck lowered, shaking the wings (2) (6). The nest is prepared by the male, and consists of a depression in the ground, around one metre wide and twelve centimetres deep, lined with dry vegetation and often hidden amongst bushes (2). The group of females all lay eggs in the same nest, so that a typical nest may contain between 20 to 30, or even up to 80, eggs, from up to twelve different females (2) (6) (13). Unusually, it is the male who incubates the eggs and rears the chicks, with the females leaving to mate with other males and lay eggs in other nests. The eggs, which are golden yellow but fade to a dull white over time, typically all hatch together, after an incubation period of 35 to 40 days (2) (6) (9). The male is an attentive and protective parent (2) (9), and, soon after hatching, leads the young away from the nest, and cares for them for another four to six months. The young keep together in a group by means of plaintive contact whistles, and may shelter under the male's wings if threatened, or if too hot or too cold. The male may even 'adopt' chicks that have become separated from other groups (2) (6) (14). The young generally remain together in a group long after the period of parental care is over, until reaching sexual maturity at around two to three years (2) (6).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The largest bird on the American continent (5) (6), the greater rhea belongs to a group of flightless birds known as 'ratites', which lack the keel of the breastbone to which the flight muscles attach in flying birds (5) (7). However, despite a superficial resemblance - which led Charles Darwin to describe the species as a “South American ostrich” (8) - the rhea is not thought to be closely related to the other members of this group, the ostrich, emu, cassowaries and kiwis (9). The plumage of the greater rhea is generally greyish-brown, with darker patches on the neck and upper back, and whitish feathers on the thighs and abdomen (2) (3) (9) (10). During the breeding season, a prominent black ring develops at the base of the neck (2). Individuals with white necks or entirely white plumage (albinos) are quite common (2) (3) (10). The greater rhea's feathers, not needed for flight, are long and plume-like (10), and the grey legs are long and powerful, with strong toes, and are adapted for running and for ranging over large distances (6) (7). Rheas have a deep, resounding call, which resembles the roar of a mammal more than the call of a bird. Mainly produced by the male during courtship, the sound of this call gives the rhea its local name, “ñandú” (2). The male and female greater rhea are similar in appearance, though the male may be slightly larger and darker. Juveniles are darker than adults, with yellowish-brown rather than grey legs, while younger birds are greyish, with dark stripes (2) (3) (6) (10). Five subspecies of greater rhea are recognised, based on variations in size and in the extent of black on the neck, although the exact characteristics and ranges of several of these subspecies are tentative (2) (3) (10). The greater rhea can be distinguished from the other rhea species, the lesser rhea (Pterocnemia pennata), by its larger size, lack of white spotting on the plumage, and featherless lower legs (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

The common rhea lives in south-eastern part of South America.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Rhea americana has a large range in north-east and south-east Brazil, east Bolivia, Paraguay, Uruguay and north-east and east Argentina south to 40°S (Folch 1992). It has declined markedly and the healthiest populations are now believed to be in parts of the Chaco region (Folch 1992).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The greater rhea is distributed throughout Brazil, Bolivia, Paraguay, Uruguay and Argentina (3) (11). Rhea americana americana is found in northeast and southeast Brazil, Rhea americana intermedia in the south of Brazil and Uruguay, Rhea americana nobilis in eastern Paraguay, Rhea americana araneipes in western Paraguay, eastern Bolivia and southern Brazil, and Rhea americana albescens in Argentina as far south as Río Negro (2) (5) (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Largest South American bird, flightless, unmistakeable due to its great height, massive legs, and terrestrial habits.

Average mass: 23 kg.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Rheas live in pampas, campos, cerrado and open chaco woodland of South America. They avoid open grassland. Rheas live in areas with at least some tall vegatation. During the breeding season, they stay near rivers, lakes, or marshes.

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Habitat and Ecology
It typically occurs in pampas, campo cerrado and open chaco woodland, normally in areas with some tall grassland and other vegetation, but also in open grassland and cultivated fields, at elevations up to 1,200 m (Canevari et al. 1991, Folch 1992, Sick 1993, Parker et al. 1996). Population densities in grassland are several times that in agricultural areas, and birds were found to occupy 51% of a grassland area, but less than 5% of an agricultural locality (Giordano et al. 2008). For breeding, it prefers areas adjacent to rivers, lakes and marshes (Folch 1992).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The greater rhea typically inhabits tall grassland, open woodland and wooded savanna, such as the pampas, cerrado, and chaco woodland habitats of South America. The species can also be found in cultivated fields, and occurs at elevations of up to 2,000 metres (2) (3) (11). For breeding, the greater rhea prefers areas close to rivers, lakes or marshes (2) (11).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Rheas are omnivorous, preferring broad-leaved plants and clover. However, they eat a variety of seeds, roots and fruits. They also eat insects, including grasshoppers; small vertebrates, such as lizards, frogs, small birds and snakes. Rheas continuously move as they feed.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Their breeding season is from August to January, depending on the region. Males court two to twelve females. Once mating has occurred, the males build nests, which are shallow holes in the ground with a rim that is surrounded by twigs and vegatation. Each of the females lay one egg in the male's nest every other day for a period of seven to ten days. After the first two or three days of egg laying, the male stays with his nest and eggs and begins incubating them. A male usually incubates ten to sixty eggs. The chicks hatch within thirty-six hours of each other. The male takes care of the chicks by himself. Female rheas move from male to male throughout the breeding season.

Key Reproductive Features: iteroparous ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Rhea americana

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCATTACCCGATGACTTTTCTCAACCAATCACAAAGATATCGGTACACTGTACCTTATCTTCGGCGCATGAGCAGGCATAGTAGGCACCGCCCTCAGCCTTCTCATCCGTGCAGAACTCGGCCAACCAGGAACCCTCCTAGGAGACGACCAAATCTACAATGTTATCGTCACTGCCCACGCTTTCGTCATAATCTTCTTTATAGTAATACCTGTAATGATCGGAGGCTTCGGAAACTGACTGGTCCCCCTTATAATCGGCGCCCCAGATATAGCTTTCCCCCGAATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCATTTCTTCTCTTACTCGCATCATCTACAGTCGAAGCAGGAGCCGGAACAGGATGAACTGTCTACCCCCCATTAGCTGGCAACCTCGCCCATGCTGGTGCCTCCGTAGACCTGGCCATCTTCTCTCTCCACCTAGCAGGGGTCTCCTCTATTCTAGGGGCCATCAACTTCATCACTACTGCAATCAATATAAAACCCCCAGCCCTCTCACAGTATCAAACACCTTTATTTGTGTGATCTGTCCTAATTACAGCCATCCTACTGCTCTTATCTCTTCCAGTCCTCGCCGCCGGTATCACTATGCTTCTTACAGATCGGAACCTCAACACCACATTCTTTGACCCTGCAGGAGGAGGAGACCCAGTTCTATACCAACATCTATTCTGGTTCTTTGGACACCCTGAAGTCTATATCTTGATCCTCCCAGGTTTCGGAATAATCTCGCACGTAGTAACCTACTATGCAGGCAAAAAAGAGCCATTCGGCTACATAGGGATAGTCTGAGCAATACTCTCAATCGGCTTTTTAGGATTTATTGTATGGGCCCACCACATGTTTACCGTAGGAATAGACGTAGACACTCGAGCCTACTTCACATCTGCCACTATAATCATCGCTATCCCAACTGGTATTAAAGTATTCAGCTGACTAGCTACCCTGCACGGAGGGACAATTAAATGAGATCCGCCTATCCTATGAGCTCTAGGCTTTATCTTCCTATTTACCATTGGAGGTCTAACGGGCATTGTCTTAGCGAACTCCTCCTTAGATATTGCCCTTCATGACACCTACTATGTAGTAGCCCACTTCCACTACGTCCTCTCTATAGGTGCTGTCTTTGCCATTCTAGCTGGCTTCACACACTGATTCCCCCTATTCACCGGCTACACCCTTCACCCCACATGAGCCAAAGCTCACTTCGGAGTCATGTTTACAGGGGTTAATCTGACCTTCTTCCCCCAACACTTCCTGGGCCTAGCTGGGATGCCACGACGATACTCCGACTACCCAGATGCGTACACGCTATGAAACACAATGTCCTCAATCGGCTCTCTAATCTCCATGACAGCCGTAATCATACTAATATTTATTATCTGAGAAGCATTCTCCTCAAAACGAAAAGTTCTCCGACCTGAACTAATTACCACCAACATCGAGTGAATCCACGGCTGCCCTCCTCCACATCACACCTTTGAAGAGCCAGCCTATGTCCAAGTCCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Rhea americana

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The rhea population has declined considerably and is considered to be near threatened. In 1980, over 50,000 skins were traded; however a permit is now needed for their export and import. Rheas and their eggs are eaten by local people. They are also killed to be used as dog food. Rhea chicks are threatened by many predators. The rhea's habitat has become limited due to agricultural progress. Rheas are eliminated near agricultural areas, because they will eat almost any crop.

IUCN Red List of Threatened Species: near threatened

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
NT
Near Threatened

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species qualifies as Near Threatened as its population is believed to have declined at a rate approaching the threshold for classification as Vulnerable.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Near Threatened (NT) on the IUCN Red List (1) and listed on Appendix II of CITES (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon to fairly common' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Its status is obfuscated by the presence of feral birds (Lowen et al. 1996), but it has declined markedly partly owing to hunting for meat and the colossal export of skins. Over 50,000 skins were traded in 1980, most apparently originating in Paraguay, with Japan and USA leading consumers (Folch 1992). In recent years, the large-scale conversion of central South American grasslands for agriculture and cattle-ranching (da Silva 1995) has considerably reduced and fragmented its available habitat, particularly in the pampas and cerrado strongholds.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The greater rhea has undergone a marked decline as a result of hunting for meat, eggs and skins, and for its feathers, which are used to make feather dusters. In recent years, these threats have been compounded by habitat loss as vast areas of grassland are converted for agriculture and cattle ranching (2) (11) (15). Farmers and ranchers often accuse rheas of eating crops and competing with cattle for food, and chase the birds off their land (2), although there is evidence that the greater rhea actually feeds on important weed and pest species (16). Physical barriers like roads and wire fences can also prevent the birds dispersing, so increasing the risk of inbreeding. In addition, the greater rhea can suffer serious injuries if it becomes caught up in barbed wire fences (2) (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CITES Appendix II

Conservation Actions Proposed
Monitor levels of illegal domestic and international trade. Effectively enforce restrictions on hunting and trade (Bellis et al. 2004). Include pastures and grasslands in agricultural ecosystems (Bellis et al. 2004). Preserve remaining natural habitat (Bellis et al. 2008, Giordano et al. 2010).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

The greater rhea is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), meaning that international trade in the species should be carefully controlled (4). However, levels of both international and domestic trade in the greater rhea may need further monitoring, and restrictions on hunting and trade need effective enforcement (11). As increasing grain production within the species' range appears inevitable, education and outreach programmes may be needed to help ensure the long-term survival of the greater rhea in agricultural areas (15). In recent decades, commercial farming of rheas for feathers, meat and skin has become increasingly popular, and studies into captive breeding of the species have led not only to improved production, but also the possibility of reintroduction of captive-bred rheas into the wild. Captive breeding has therefore been suggested as a possible conservation tool as wild populations continue to decline (5) (17).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Rheas are a pest to farmers because they will eat almost any agricultural crop.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Rhea feathers are used to make feather dusters in South America. Their skins are used for leather, their meat and eggs are consumed by man and dogs.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Greater rhea

The greater rhea (Rhea americana) is a flightless bird found in eastern South America. Other names for the greater rhea include the grey, common, or American rhea; ñandú (Guaraní); or ema (Portuguese). One of two species in the genus Rhea, in the family Rheidae, the greater rhea is endemic to Argentina, Bolivia, Brazil, Paraguay and Uruguay. It inhabits a variety of open areas, such as grasslands, savanna or grassy wetlands. Weighing 50–55 pounds (23–25 kg), the greater rhea is the largest bird in South America.[5] In the wild, the greater rhea has a life expectancy of 10.5 years.[6] It is also notable for its reproductive habits, and for the fact the that a group has established itself in Germany in recent years.[7]

Taxonomy and systematics[edit]

The greater rhea derives its scientific name from Rhea, a Greek goddess, and the Latinized form of America.[8] It was originally described by Carolus Linnaeus[5] in his 18th-century work, Systema Naturae under the name Struthio camelus americanus.[3] He identified specimens from Sergipe, and Rio Grande do Norte, Brazil, in 1758.[5] They are from the family Rheidae, and the order Struthioniformes, commonly known as ratites. They are joined in this order by emus, ostriches, cassowaries, and kiwis, along with the extinct forms moas, and elephant birds.

Subspecies[edit]

There are five subspecies of the greater rhea; their ranges meet around the Tropic of Capricorn:[9]

Main subspecific differences are the extent of the black coloring of the throat and the height.[2] However, subspecies of the greater rhea differ so little across their range that, without knowledge of the place of origin, it is essentially impossible to identify captive birds by subspecies.[9]

Description[edit]

Greater rhea, closeup, Cricket St Thomas Wildlife Park (Somerset, England)

The adults have an average weight of 20–27 kg (44–60 lb) and often measure 127 to 140 cm (50 to 55 in) long from beak to tail; they usually stand about 1.5 m (4.9 ft) tall to the top of the head.[5] The males are generally bigger than the females. Large males can weigh up to 40 kg (88 lb), stand nearly 1.83 m (6.0 ft) tall and measure over 150 cm (59 in) long, although this is rare.[5][11][12]

The head and bill are fairly small, the latter measuring 8–10.4 cm (3.1–4.1 in) in length.[5] The legs are long, with the tarsus measuring between 33.5 and 37 cm (13.2 and 14.6 in),[5][13] and strong and have 22 horizontal plates on the front of the tarsus. They have three toes, and the hind toe is absent. The wings of the American rhea are rather long; the birds use them during running to maintain balance during tight turns, and also during courtship displays.

Greater rheas have a fluffy, tattered-looking plumage, that is gray or brown, with high individual variation, The head, neck, rump, and thighs are feathered.[5] In general, males are darker than females. Even in the wild—particularly in Argentina—leucistic individuals (with white body plumage and blue eyes) as well as albinos occur. Hatchling greater rheas are grey with dark lengthwise stripes.[9]

Distribution and habitat[edit]

The greater rhea is endemic to Argentina, Bolivia, Brazil, Paraguay, and Uruguay.[1] This species inhabits grassland dominated by satintail (Imperata) and bahiagrass (Paspalum) species,[12] as well as savanna, scrub forest, chaparral, and even desert and palustrine[14] lands, though it prefers areas with at least some tall vegetation. It is absent from the humid tropical forests of the Mata Atlântica and planalto uplands along the coast of Brazil[15] and extends south to 40° latitude. They prefer lower elevation and seldom go above 1,200 metres (3,900 ft).[6] During the breeding season (spring and summer), it stays near water.

A small non-indigenous population of the greater rhea established itself in Germany. Three pairs escaped from a farm in Groß Grönau, Schleswig-Holstein, in August 2000. These birds survived the winter and succeeded in breeding in a habitat sufficiently similar to their native South American range. They eventually crossed the Wakenitz river and settled in Nordwestmecklenburg in the area around and particularly to the north of Thandorf village.[16] A biosurvey conducted in late 2012 found the population has grown to more than 100 and is settling in permanently.[17]

Behavior and ecology[edit]

Individual and flock behavior[edit]

The greater rhea is a silent bird except during mating season, when they make low booming noises, and as chicks, when they give a mournful whistle.[5] During the non-breeding season they will form flocks of between 10 and 100 birds. When in flocks, they tend to be less vigilant, but the males can get aggressive towards other males. When chased they will flee in a zigzag pattern, alternately raising one wing then the other. These flocks break up in the winter in time for breeding season.[5]

Feeding and diet[edit]

Wild greater rhea (probably R. a. albescens) in habitat. Goya Department, Corrientes Province, Argentina

The rhea's diet mainly consists of broad-leaved foliage, particularly seed and fruit when in season, but also insects, scorpions, small rodents, reptiles, and small birds. Favorite food plants include native and introduced species from all sorts of dicot families, such as Amaranthaceae, Asteraceae, Bignoniaceae,[18] Brassicaceae, Fabaceae,[18] Lamiaceae,[18] Myrtaceae[18] or Solanaceae.[18] Magnoliidae fruit, for example of Duguetia furfuracea (Annonaceae) or avocados (Persea americana, Lauraceae) can be seasonally important. They do not usually eat cereal grains, or monocots in general. However, the leaves of particular grass species like Brachiaria brizantha can be eaten in large quantities, and Liliaceae (e.g. the sarsaparilla Smilax brasiliensis) have also been recorded as foodplants. Even tough and spiny vegetable matter like tubers or thistles is eaten with relish. Like many birds which feed on tough plant matter, the greater rhea swallows pebbles which help grind down the food for easy digestion. It is much attracted to sparkling objects and sometimes accidentally swallows metallic or glossy objects.[9][18]

Feral greater rhea in cereal field in Mecklenburg-Vorpommern, Germany. The species normally uses such monocultures to hide rather than to feed on the plants.

In fields and plantations of plants they do not like to eat, e.g., cereals or eucalyptus, the greater rhea can be a species quite beneficial to farmers. It will eat any large invertebrate it can catch; its food includes locusts and grasshoppers, true bugs, cockroaches, and other pest insects. Juveniles eat more animal matter than adults. In mixed cerrado and agricultural land in Minas Gerais (Brazil), R. a. americana was noted to be particularly fond of beetles. It is not clear whether this applies to the species in general but for example in pampas habitat, beetle consumption is probably lower simply due to availability while Orthoptera might be more important. The greater rhea is able to eat Hymenoptera in quantity. These insects contain among them many who can give painful stings, though the birds do not seem to mind. Sometimes, greater rheas will gather at carrion to feed on flies; they are also known to eat dead or dying fish in the dry season, but as vertebrate prey in general not in large quantities.[9][18]

Reproduction[edit]

Two-month old greater rhea in Tierpark Hagenbeck with hatchling at its feet

After the large flocks break up in the winter, they form into three loose groups: single males, flocks of between two to fifteen females, and a large flock of yearlings. As this time approaches, males become more aggressive towards each other. Then they start courting females by calling and raising the front of their body up while keeping their neck straight and ruffling their plumage. They will raise their wings and may run some distance like this, sometime flapping their wings methodically. After doing this and attracting females, they will continue calling at a specific female, and will start to either walk alongside her or in front of her while spreading his wings and lowering his head. As the display continues, he will get more intense and animated and start waving his neck around and in figure eights. Once he has attracted a first mate he will copulate with her and then lead her to his nest.[5] When it is time for the eggs to be laid, the male will typically be on the nest already and will act aggressive when approached by the female, covering his nest with his wings. He will gradually relax and allow her to crouch and lay the egg at the edge of the nest. The male will roll the egg into his nest. Males are simultaneously polygynous, females are serially polyandrous. In practice, this means that the females move around during breeding season, mating with a male and depositing their eggs with the male before leaving him and mating with another male. Males on the other hand are sedentary, attending the nests and taking care of incubation and the hatchlings all on their own. Although recent evidence suggest that dominant males may enlist a subordinate male to roost for him while he starts a second nest with a second harem.[5] The nests are thus collectively used by several females and can contain as many as 80 eggs laid by a dozen females; each individual female's clutch numbers some 5–10 eggs.[9] However, the average clutch size is 26 with 7 different females eggs.[5] Recent evidence has shown that some males will utilize subordinate males to help incubate and protect the eggs. If this happens, the dominant male will find a second harem and start the process over again.[5]

Rhea eggs measure about 130 mm × 90 mm (5.1 in × 3.5 in) and weigh 600 g (21 oz) on average; they are thus less than half the size of an ostrich egg. Their shell is greenish-yellow when fresh but soon fades to dull cream when exposed to light. The nest is a simple shallow and wide scrape in a hidden location; males will drag sticks, grass, and leaves in the area surrounding the nest so it resembles a firebreak as wide as their neck can reach. The incubation period is 29–43 days. All the eggs hatch within 36 hours of each other even though the eggs in one nest were laid perhaps as much as two weeks apart.[5] As it seems, when the first young are ready to hatch they start a call resembling a pop-bottle rocket or even fireworks, even while still inside the egg, thus the hatching time is coordinated. Greater rheas are half-grown about three months after hatching, and sexually mature by their 14th month.

Predators[edit]

The natural predators of adult greater rheas are limited to the cougar (Puma concolor) and the jaguar (Panthera onca). Feral dogs are known to kill younger birds, and the southern caracara (Caracara plancus) is suspected to prey on hatchlings. Armadillos sometimes feed on greater rhea eggs; nests have been found which had been undermined by a six-banded armadillo (Euphractus sexcinctus) or a big hairy armadillo (Chaetophractus villosus) and the rhea eggs were broken apart.[12]

Captive-bred greater rheas exhibit significant ecological naïvete. This fearlessness renders them highly vulnerable to predators if the birds are released into the wild in reintroduction projects. Classical conditioning of greater rhea juveniles against predator models can prevent this to some degree, but the personality type of the birds – whether they are bold or shy – influences the success of such training. In 2006, a protocol was established for training greater rheas to avoid would-be predators, and for identifying the most cautious animals for release.[19]

Status and conservation[edit]

The greater rhea is considered a Near Threatened species according to the IUCN, and they have a decreasing range of about 6,540,000 square kilometres (2,530,000 sq mi).[6] The species is believed to be declining due to increased hunting[1] and the conversion of central South American grasslands to farmland and ranchland.[20] The populations of Argentina and Uruguay are most seriously affected by the decline.[9]

Farmers sometimes consider the greater rhea pests, because they will eat broad-leaved crop plants, such as cabbage, chard and bok choi.[21] Where they occur as pests, farmers tend to hunt and kill greater rheas. The burning of crops in South America has also contributed to their decline.[22]

International trade in wild-caught greater rheas is restricted as per CITES Appendix II.[23]

The rheas in Germany are legally protected in a similar way to native species. In its new home, the greater rhea is considered generally beneficial as its browsing helps maintain the habitat diversity of the sparsely populated grasslands bordering the Schaalsee biosphere reserve.[16]

Relationship with humans[edit]

This species is farmed in North America and Europe similar to the Emu and Ostrich. The main products are meat and eggs, but rhea oil is used for cosmetics and soaps and rhea leather is also traded in quantity. Male greater rheas are very territorial during the breeding season. The infant chicks have high mortality in typical confinement farming situations, but under optimum free-range conditions chicks will reach adult size by their fifth month.

Footnotes[edit]

  1. ^ a b c BirdLife International (2012). "Rhea americana". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g Blake, E.R. (1977)
  3. ^ a b Linnaeus, C. (1758)
  4. ^ Peters, James L. (1931)
  5. ^ a b c d e f g h i j k l m n o Davies, S. J. J. F. (2003)
  6. ^ a b c Birdlife International (2008)
  7. ^ Navarro & Martella (2011), p. 238
  8. ^ Gotch, A.F. (1995)
  9. ^ a b c d e f g Folch, A. (1992)
  10. ^ a b c d e Hodes, C. (2010)
  11. ^ McFie, H. (2003)
  12. ^ a b c Mercolli, C. & Yanosky, A. (2001)
  13. ^ Bologna, G. (1981)
  14. ^ Accordi, I. & Barcellos, A. (2006)
  15. ^ Bencke, G. (2007)
  16. ^ a b Schuh, H. (2003)
  17. ^ 3sat.de, March 4, 2013, accessed: October 13, 2013.
  18. ^ a b c d e f g Azevedo et al. (2006)
  19. ^ Azevedo, C. S. de & Young, R. (2006)
  20. ^ Giordano, P.F. et al. (2008)
  21. ^ Elliott, Andrew (1992)
  22. ^ Goriup, P.D. (1988)
  23. ^ CITES (1990)

References[edit]

  • Accordi, Iury Almeida; Barcellos, André. "Composição da avifauna em oito áreas úmidas da Bacia Hidrográfica do Lago Guaíba, Rio Grande do Sul [Bird composition and conservation in eight wetlands of the hidrographic basin of Guaíba lake, State of Rio Grande do Sul, Brazil]". Revista Brasileira de Ornitologia (in Portuguese with English abstract) 14 (2): 101–115. 
  • Azevedo, Cristiano Schetini de; Penha Tinoco, Herlandes; Bosco Ferraz, João; Young, Robert John (2006). "The fishing rhea: a new food item in the diet of wild greater rheas (Rhea americana, Rheidae, Aves)". Revista Brasileira de Ornitologia (in English with Portuguese abstract) 14 (3): 285–287. 
  • Azevedo, Cristiano Schetini de; Young, Robert J. (2006). "Shyness and boldness in greater rheas Rhea americana Linnaeus (Rheiformes, Rheidae): the effects of antipredator training on the personality of the birds". Revista Brasileira de Zoologia (in English with Portuguese abstract) 23 (1): 202–210. doi:10.1590/S0101-81752006000100012. 
  • Bencke, Glayson Ariel (2007-06-22). "Avifauna atual do Rio Grande do Sul, Brasil: aspectos biogeográficos e distribucionais [The Recent avifauna of Rio Grande do Sul: Biogeographical and distributional aspects]". Quaternário do RS: integrando conhecimento, Canoas, Rio Grande do Sul, Brazil. 
  • Bologna, Gianfranco. "Rhea americana Greater Rhea". In Bull, John. Simon & Schuster's Guide to Birds of the World. New York, NY: Simon & Schuster. ISBN 0-671-42234-0. 
  • Clements, James (2007). The Clements Checklist of the Birds of the World (6 ed.). Ithaca, NY: Cornell University Press. ISBN 978-0-8014-4501-9. 
  • Davies, S.J.J.F. (2003). "Rheas". In Hutchins, Michael. Grzimek's Animal Life Encyclopedia. 8 Birds I Tinamous and Ratites to Hoatzins (2 ed.). Farmington Hills, MI: Gale Group. pp. 69–73. ISBN 0-7876-5784-0. 
  • Elliott, Andrew (1992). "Genus Rhea". In Josep del Hoyo, Jordi Sargatal, José Cabot. Handbook of the Birds of the World 1. Lynx Edicions. pp. 84–88. ISBN 84-87334-10-5. 
  • Giordano, Paola F.; Bellis, Laura M.; Navarro, Joaquín L.; Martella, Mónica B. (2008). "Abundance and spatial distribution of Greater Rhea Rhea americana in two sites on the pampas grasslands with different land use". Bird Conservation International 18 (1). doi:10.1017/S0959270908000075. 
  • Goriup, Paul D. (1988). Ecology and conservation of grassland birds. BirdLife International. p. 61. ISBN 0-946888-11-6. 
  • Gotch, A.F. (1995) [1979]. "Rheas". Latin Names Explained. A Guide to the Scientific Classifications of Reptiles, Birds & Mammals. New York, NY: Facts on File. p. 177. ISBN 0-8160-3377-3. 
  • Korthals, A.; Philipp, F. (2008). "Invasive species - How prepared are we?". International conference at the Brandenburgische Akademie "Schloss Criewen", Criewen, Germany. 
  • Mercolli, Claudia; Yanosky, A. Alberto (2001). "Greater rhea predation in the Eastern Chaco of Argentina". Ararajuba 9 (2): 139–141. 
  • Navarro, J. L.; Martella, M. B. (2011). "Ratite Conservation: Linking Captive-Release and Welfare". In Glatz, Phil; Lunam, Christine; Malecki, Irek. Animal Welfare, vol. 11: The Welfare of Farmed Ratites. Berlin, Germany: Springer. pp. 237–258. ISBN 978-3-642-19296-8. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!