Overview

Distribution

Emus (Dromaius novaehollandiae) are found exclusively in Australia and inhabits nearly the entire continent. Lower densities exist along the eastern coast and toward the center of the island. The number of individuals varies around 700,000, and is dependent on the seasonal rains.

Biogeographic Regions: australian (Native )

Other Geographic Terms: island endemic

  • Blakers, M., S. Davies, P. Reilly. 1984. The Atlas of Australian Birds. Melbourne, Australia: Melbourne University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range Description

Dromaius novaehollandiae is distributed throughout mainland Australia (del Hoyo et al. 1992). The Tasmanian subspecies diemenensis is extinct, with the last wild record dating from 1845 (Dove 1924).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Emus have many physical characteristics in common with the ostrich, which are the only birds taller than the emu. Emus can reach a maximum height of 190 cm, with the average at 175 cm. Emus feet are similar in design to other running birds, having three forward-facing toes and no rearward-facing toes.  Emus have long bare legs, similar to other flightless birds Ratites. Emus are the only bird with calf muscles, making them more adapted to sprinting and long distance running. These strength adaptations allow them to sustain speeds up to 13.4 m/s, with an average 3 meter stride. The high strength of these legs allows them to perform extremely powerful kicks capable of breaking through fences or maiming predators. The average weight of an emu is 36 to 40 kilograms, with females being slightly by not significantly larger. Their plumage of shaggy dark brown feathers is not streamlined, as its main purpose is insulation from direct sunlight. This plumage has some variation due to environment, and will often reflect the general hue of its surroundings. Young emus will have additional camouflage in the form of longitudinal tan stripes on their much thinner plumage.  Emus have very small vestigial wings capable of flapping, although they do not aid in mobility. They have a long, sparsely covered neck that is whitish-blue. Their heads are covered in wispy black feathers, and have a large black beak specialized for grazing.

Range mass: 36 to 40 kg.

Range length: 190 (high) cm.

Average length: 175 cm.

Sexual Dimorphism: female larger

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Emus, with their nomadic lifestyle, will occupy nearly all available biomes in Australia. Savannah forest, grassland, and subtropical climates are preferred. Emus tend to gravitate toward areas with standing water and are seen most often in savannah areas. They avoid heavily wooded areas and desertified regions, due to water needs.

Range elevation: 0 (low) m.

Average elevation: 330 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; forest

Other Habitat Features: agricultural

  • Drenowatz, C. 1995. Ratite Encyclopedia: Ostrich, Emu, Rhea. United States: Ratite Records, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Emus primarily feed on fruits, seeds, insects, and small animals. Emus will also feed on animal droppings, and will reject leaves and dry grasses. Emus have no crop for storing or breaking down food, but instead have a modified esophagus that is able to store food upwards of 30 minutes before entering the stomach. Since emus may experience starvation for weeks, they are able to store large amounts of fat in preparation. Emus are able to lose more than half their body mass during these long starvation periods. This adaptation also allows the male emus to endure an entire encubation period without food.

Animal Foods: mammals; amphibians; reptiles; insects; terrestrial non-insect arthropods

Plant Foods: wood, bark, or stems; seeds, grains, and nuts; fruit

Other Foods: dung

Primary Diet: carnivore (Insectivore ); herbivore (Frugivore , Granivore , Lignivore); omnivore ; coprophage

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Emus disperse seeds of many low growing plants over wide ranges, because of their nomadic migratory patterns. Some seeds have a specialized coating that, after digestion, increases their chances of sprouting. The emu can impact farmlands that are not fenced in, due to the herd growing nature of migrating emus searching for food. Many small insects fall prey to the emus, who will eat opportunistically. Emus are often hunted by dingoes and hawks. Internal parasites have been documented in emus. Roundworms have caused illnesses and deaths of captice emus via cerebrospinal nematodiasis. Lungworms inhabit respiratory organ and nematodes infect the brains of emus.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Kazacos, K., S. Fitzgerald, W. Reed. 1991. Baylisascaris procyonis as a cause of cerebrospinal nematodiasis in ratites. Journal of Zoo and Wildlife Medicine, 22/4: 460-465.
  • Law, J., T. Tully, T. Stewart. 1993. Verminous encephalitis apparently caused by the filarioid nematode Chandlerella quiscali in emus (Dromaius novaehollandiae). Avian Diseases, 37/2: 597-601.
  • Rickard, L., L. Steinohrt, S. Black. 1997. Subclinical cyathostomiasis and unidentified helminthiasis in a juvenile emu (Dromaius novaehollandiae). Avian Diseases, 41/4: 993-996.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The primary predator of emus are dingoes. Dingoes mainly threaten the nests, consuming the eggs. One dingo will distract the incubating male, so that the nest becomes exposed. When attacking emus, predators will target the head and neck. To defend against dingo attacks, emus exploit their height by quickly leaping away. Emus will leap to put distance between the dingo's mouth and their neck. This is often accompanied by a kicking defense, which can be lethal for the dingo. Against eagles and hawks, emus have little practical defense. The wedge-tailed eagle, will attempt to break their neck by tackling them after a dive. Emus can only run wildly and unpredictably, seeking cover (a rarity in their habitat).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Emus have the ability to communicate by using an inflatable neck sack, and can create sounds loud enough to be heard 2 km away. The name "emu" resembles its signature call, heard as "e-moo". Translating these calls is the main form of receiving communication, aside from visually interpreting body language. During courtship, the emu male and female participate in a dance consisting of struts and snake-like head movements. Males must make the correct moves, otherwise the female can rapidly change her mind and become aggressive.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

When in captivity, under a regular hydration and feeding schedule, emus are able to live up to 20 years. Emus in the wild experience many more stresses, including dry periods and starvation, which reduces their lifespan to a max of ten years.

Range lifespan

Status: wild:
5 to 10 years.

Average lifespan

Status: wild:
7 years.

Range lifespan

Status: captivity:
15 to 20 years.

Average lifespan

Status: captivity:
16 years.

Typical lifespan

Status: wild:
5 to 10 years.

Average lifespan

Status: wild:
7 years.

Typical lifespan

Status: captivity:
15 to 20 years.

Average lifespan

Status: captivity:
16 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 16.6 years (captivity)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Emus exhibit polyandrous breeding patterns, but not all females engage multiple partners. Mating season begins in December-January, which starts with the male and female emu engaging in a courtship dance. The result is dependent on the male emu's performance; if his it is unsatisfactory the female may become aggressive. Success of the male emu means up to five months of mating privileges with the courted female. Before the female emu lays her eggs, their male counterpart may court other females before being occupied with incubation. After the males begin the incubation period, the female emus will seek to mate with unoccupied males. Most female emus engage in post-mating period polygamy, however not without a cost. Female emus run the risk of losing their mate, which could mean her eggs will not be incubated. To prevent this, some will guard the male from accessing other females. In the relationship, the female emu is most responsible for keeping order in the pair formation, until incubation begins when the male becomes aggressive to all other emus.

Mating System: polygynandrous (promiscuous)

When emus reach sexual maturity at 18 to 20 months, they engage in mating practices. After pairing, emus will breed until eggs are laid. From insemination, this is 48 to 56 days. Female emus are able to store sperm, allowing them to continue laying eggs every 3 days after her initial clutch. This initial clutch can range from 5 to 24 eggs. She will create more nests if necessary, which will be incubated by another male emu. A single nest may contain the eggs of several females. Male emus are responsible for egg incubation, which starts after the last egg is laid in order to minimize the incubation period. In the incubation period, male emus generally do not consume food, drink, or pass waste; they are able to survive on stored fat alone. After 48 to 56 days of incubation, the all the eggs will hatch within a period of days. The average birthweight is 500 grams.

Breeding interval: Emus begin their breeding cycle once yearly.

Breeding season: Emus begin breeding in December to January, up to once daily. Nesting occurs around 50 days after breeding.

Range eggs per season: 5 to 24.

Average eggs per season: 10.

Range time to hatching: 48 to 56 days.

Average time to hatching: 50 days.

Range time to independence: 15 to 18 months.

Average time to independence: 18 months.

Range age at sexual or reproductive maturity (female): 18 to 20 months.

Average age at sexual or reproductive maturity (female): 18 months.

Range age at sexual or reproductive maturity (male): 18 to 20 months.

Average age at sexual or reproductive maturity (male): 18 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous ; sperm-storing

After female emus lay their eggs, they have little to do with them other than occasionally visiting the incubating male. Male emus are defensive toward all other emus, and takes great care in protecting the nest. Male emus find a suitable location for their mate's eggs, and will build up a bed of dead grass and foliage surrounded by larger brush. Because this nest is largely flat, male emus take special care to gather the eggs that roll away. Male emus rotate and turn the eggs every few hours to ensure consistency of incubation and hatching time. After hatching, males will protect the flock and teach them how to procure food. Males maintain their aggressive disposition toward all other emus, even the mother. This period of dependence lasts up to 7 months, after which the emus are fully grown. Emus are independent from the flock in 15 to 18 months.

Parental Investment: male parental care ; pre-fertilization (Protecting: Male); pre-hatching/birth (Provisioning: Male, Protecting: Male); pre-independence (Provisioning: Male, Protecting: Male); extended period of juvenile learning

  • Blakers, M., S. Davies, P. Reilly. 1984. The Atlas of Australian Birds. Melbourne, Australia: Melbourne University Press.
  • Blanche, D., C. Barrett, G. Martin. 2000. Social mating system and sexual behaviour in captive Emus Dromaius novaehollandiae. The Journal of the Royal Australasian Ornithologists' Union, 100/3: 161-168.
  • Dzialowski, E., P. Sotherland. 2004. Maternal effects of egg size on emu Dromaius novaehollandiae egg composition and hatchling phenotype. The Journal of Experimental Biology, 207: 597-606.
  • Patodkar, V., S. Rahane, M. Shejal, D. Belhekar. 2009. Behavior of emu bird (Dromaius novaehollandiae). Veterinary World, 2/11: 439-440.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Dromaius novaehollandiae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACATTCATTACTCGATGATTTTTTTCTACAAACCACAAAGACATTGGCACACTATACCTCATCTTTGGTGCATGAGCAGGCATAGTAGGTACAGCCCTCAGCCTACTTATCCGTGCTGAACTAGGCCAACCAGGAACACTACTAGGAGATGACCAAATCTATAATGTAGTCGTCACTGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCCGTAATGATCGGAGGCTTTGGAAACTGACTAGTTCCACTTATAATTGGTGCTCCAGACATGGCATTCCCCCGAATAAATAACATGAGCTTTTGACTCTTACCTCCATCCTTCCTATTACTACTAGCATCATCCACAGTCGAAGCAGGAGCAGGAACAGGATGAACAGTATACCCTCCACTGGCTGGAAATCTTGCCCATGCAGGGGCTTCTGTAGATCTTGCCATTTTTTCACTTCACTTAGCTGGTGTTTCCTCCATCCTAGGGGCAATCAACTTTATCACTACCGCTATCAACATAAAACCACCAGCCCTCACACAATACCAAACACCCCTGTTCGTATGATCTGTACTAATCACTGCCATCCTTCTCCTACTATCGCTCCCAGTACTTGCTGCTGGCATTACCATACTCCTCACAGACCGAAACCTTAACACCACATTCTTTGACCCCGCTGGAGGAGGAGACCCCGTACTATACCAACACCTCTTCTGATTCTTCGGCCACCCTGAAGTCTACATCTTAATTCTCCCAGGCTTTGGAATAATCTCTCATGTAGTGACTTATTACGCAGGGAAAAAAGAACCTTTTGGATATATAGGAATAGTATGAGCCATATTATCTATCGGATTCCTGGGCTTTATTGTATGAGCCCATCACATATTCACCGTAGGAATAGATGTAGACACTCGAGCCTACTTCACATCCGCTACCATAATCATCGCTATCCCAACTGGTATTAAGGTATTCAGCTGATTAGCTACCTTACATGGAGGGACAATCAAATGAGACCCTCCTATTCTATGAGCCTTAGGCTTTATCTTCCTGTTCACTATCGGAGGTCTAACTGGCATCGTACTAGCAAACTCCTCCCTAGACATCGCCCTACATGATACATACTACGTAGTAGCCCATTTCCATTATGTCCTCTCCATGGGGGCTGTTTTTGCTATCTTGGCAGGCTTCACACACTGATTCCCCCTATTTACCGGATACACCCTCCATCCAACCTGAGCAAAAGCCCACTTCGGAGTTATATTTACAGGAGTCAATCTAACCTTCTTCCCACAACACTTCCTAGGCCTAGCCGGAATACCACGACGATACTCAGACTATCCAGATGCCTACACCCTATGAAACACCTTATCCTCTATTGGCTCCCTAATCTCTATAACAGCTGTAATCATACTAATATTTATCATCTGGGAGGCATTCTCTTCAAAACGAAAAGTTGCCCAACCAGAACTAATCCCAACCAACATTGAGTGAATCCATGGCTGCCCACCCCCACATCACACCTTTGAAGAACCAGCCTATGTTCAAGTCCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Dromaius novaehollandiae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The emu lives in abundance in mainland Australia. In Tasmania however, the population was decimated when it was hunted by European settlers.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

If given the opportunity, emus will forage on crops. Farmers now install tall fences so emus cannot access farmland. In the early 1930s, a large migration of emus to an agricultural town ended violently. The emus spoiled or consumed vast wheat fields. The military was called in to eradicate the emus in what some call the "Emu War". However the operation was unsuccessful. The emus have natural camouflage and ability to flee, which allowed them to avoid detection.

Negative Impacts: crop pest

  • Johnson, M. 2006. Feathered foes: Soldier settlers and western Australia's emu war of 1932. Journal of Australian Studies, 30/88: 147-157.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Emus produce oil that has been used for medicinal purposes for hundreds of years. A short list of therapeutic effects include lowering cholesterol, treating allergies, preventing scarring and stretch marks, and treating headaches. Tests suggest statistically that emu oil is a superior skin cream to mineral oil-based products. Emus have also been hunted for meat by aboriginal people and contemporary Australians.

Positive Impacts: food ; source of medicine or drug

  • Zemstov, A., M. Gaddis, V. Montalvo-Lugo. 1996. Moisturizing and cosmetic properties of emu oil: A pilot double blind study. Australian Journal of Dermatology, 37/3: 159-162.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!