Overview

Brief Summary

Description

Cassowaries are large, flightless birds that are related to emus and found only in Australia and New Guinea (2). The southern cassowary has a glossy black plumage and a bright blue neck, with red colouring at the nape (3). Two wattles of bare, red coloured skin hang down from the throat. Cassowaries have stout, powerful legs and long feet with 3 toes; the inner toe on each foot has a sharp claw that can reach up to 80 millimetres in length (4). The name cassowary comes from a Papuan name meaning 'horned head', referring to the helmet of tough skin born on the crown of the head. This helmet (or casque) slopes backwards and is used to push through vegetation as the cassowary runs through the rainforest with its head down; it also reflects age and dominance. The sexes are similar in appearance although females tend to be larger and heavier. Chicks are striped black and cream; fading to brown after around five months. The adult colouring and casque begin to develop between two and four years of age (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Cassowaries are usually solitary individuals, and males are subordinate to females if they meet. Females may lay several clutches of eggs during the breeding season that runs from June to October. These are laid directly onto the forest floor and the male then takes sole responsibility for their care. The male incubates the eggs for around 50 days, turning the eggs and only leaving his charges in order to drink. He cares for his offspring for up to 16 months, protecting them under his tail if threatened (4). Cassowaries fight by kicking out with their legs, they have a fearsome reputation but their diet is composed almost entirely of fruit. These birds are important dispersers of a number of rainforest seeds, ranging far in search of fruiting trees (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Casuarius casuarius is found in New Guinea (Papua, formerly Irian Jaya, Indonesia and Papua New Guinea), including the islands of Seram (where probably introduced) and Aru, and north-eastern Australia. It occurs throughout the lowlands of New Guinea except for the northern watershed from the Vogelkop to the Huon Peninsula (Coates 1985, Beehler et al. 1986). In Papua and adjacent islands, its status is unclear, but it may be more common than in Papua New Guinea. In Papua New Guinea, it has declined, and is now absent in some locations, including remote areas (Coates 1985, K. D. Bishop in litt. 1999). In Australia, there are 3 subpopulations in Queensland. The southern and largest population ranges from the Paluma Range north of Townsville to Mt Amos. Two populations occur further north on Cape York Peninsula: one in the McIlwraith Range and north to the Pascoe River, the other in the Jardine River National Park and Heathland Resources Reserve (Kofron and Chapman 2006). The Australian population was estimated to number c. 2,500 birds in 2010, but it is declining (Garnett et al. 2011).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern cassowaries are found in New Guinea, Cape York, Ceram and Aru Islands.

Biogeographic Regions: australian (Introduced , Native ); oceanic islands (Introduced , Native )

Other Geographic Terms: island endemic

  • 1985. Ostriches and their Relatives - The Ratites. Pp. 19-27 in C Perrins, A Middleton, eds. The Encyclopedia of Birds, Vol. 1, First Edition. New York: Facts on File.
  • 2003. Cassowaries. Pp. 75-81 in J Jackson, W Bock, D Olendorf, eds. Grizmek's Animal Life Encyclopedia, Vol. 8, Second Edition. New York: Thomson Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Humid forests of ne Australia, New Guinea and Aru Islands.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

The southern cassowary is found in New Guinea as well as Queensland in northeastern Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Southern cassowaries are large, robust birds with long powerful legs for running and defense; the claws on the toes are up to 12 cm long. Their bodies are covered with dark brown or black feathers which look more like thick, coarse hair. The neck and head have no feathers and are boldly colored blue and red. On their heads there is a large bony casque which is made of trabecular bone and cartilage. The wings are extremely small and there are vestiges of primary feathers in the form of five or six long white spines. Cassowary chicks are brown with black stripes running the length of their bodies for their first three to six months. Juveniles are brown instead of black and have smaller casques. They do not get the vividly colored necks until they are about one year old. Females are 127 to 170 cm long and up to 59 kg, are larger than the males which are 29 to 34 kg. Southern cassowaries are the largest of the three species of cassowary and the only species to have have two bright red flaps of skin, called wattles, hanging from their neck.

Range mass: 29 to 59 kg.

Range length: 102 to 170 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a solitary and sedentary inhabitant of rainforest, occasionally using adjacent savannah forests, mangroves and fruit plantations. Its diet largely comprises fallen fruit, although it is fairly undiscriminating (Garnett et al. 2011). It ranges between 0 m and at least 500 m in Papua New Guinea (Johnson et al. 2004), and has been recorded up to 1,400 m in Australia.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Southern cassowaries live primarily in lowland rainforests, typically less than 1,100 meters elevation, and occasionally are found in eucalyptus forests, savannas, palm scrub, and in forested swamps.

Range elevation: 0 to 1,100 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

  • Barrett, N. 1991. Flightless Birds. New York: Franklin Watts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

These birds are rainforest inhabitants, although they are also found in nearby savannah, mangroves and fruit plantations (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Southern cassowaries are frugivorous, feeding mostly on fruits from canopy species in the forests where they live. Because these birds cannot fly they must rely on finding fruit that has fallen to the ground. They also eat insects, small vertebrates, and fungi. Inspection of the feces reveals that commonly ingested fruits are Davidsonia pruriens, Acemena divaricata and members of the laurel family (Lauraceae).

Animal Foods: mammals; amphibians; reptiles; insects; terrestrial non-insect arthropods

Plant Foods: fruit

Other Foods: fungus

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Cassowaries live primarily on fruit from a large number of species of trees. When cassowaries eat the fruit the seeds pass through their system and are dispersed far from where they originally fell. The seeds are often still viable after passing through the digestive system of cassowaries. In a typical pile of cassowary dung there can be as much as one kilogram of seeds. In a study of the effects of seed dispersal by cassowaries, the seeds from 78 species of plants were found and 70 of these species' seeds were able to germinate after being passed through the cassowaries. Some of the species found in cassowaries dung include Davidsonia pruriens, Acemena divaricata, Polyalthia michaelii, Acronychia acronychioides and a large number from the Lauraceae family.

Ecosystem Impact: disperses seeds

Mutualist Species:

  • laurels (Lauraceae)
  • mulberries (Moraceae)
  • palms (Arecaceae)
  • myrtles (Myrtaceae)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

It is unknown whether cassowaries have any natural predators, but humans could be considered a predator because cassowaries are sometimes eaten by humans.

Known Predators:

  • Humans Homo sapiens 

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Southern cassowaries communicate with each other by issuing very loud deep roars which travel well through the forest. These roars are up to 40 decibels louder than the surrounding forest noise, and are at frequencies which are at the very bottom end of what humans can perceive, about 23 Hertz. Cassowaries are one of the only birds to have been recorded making vocalizations this low. There is some speculation about whether the casques on their heads are somehow related to these impressive sounds. It is speculated that the casque could play a role in receiving or producing these sounds. These calls are territorial, warning other cassowaries of their presence.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

There is little known about the lifespan of southern cassowaries in the wild, but in captivity southern cassowaries have lived 20 to 40 years.

Range lifespan

Status: captivity:
20 to 40 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Females are polyandrous; a female will usually breed with two to three males throughout the mating season, starting a new nest every time, which the male will incubate. Courtship consists of the males making a “boo-boo-boo” call while inflating his throat.

Mating System: polyandrous

The breeding season is in winter, when fruit is most abundant. The nest is a pad of vegetation on the ground and there are typically about 4 bright green eggs in a clutch. Incubation, which is exclusively done by the males, lasts for 47 to 61 days. Once the chicks hatch they stay with their father until they become independent at about nine months. At about three years of age, southern cassowaries are able to reproduce.

Breeding interval: Females will mate with 2 to 3 males during the mating season.

Breeding season: Breeding occurs during the austral winter, from June to July.

Range eggs per season: 4 to 8.

Range time to hatching: 47 to 61 days.

Average time to independence: 9 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

After the eggs are laid all care of the eggs and offspring are done by males. Males construct a mat of vegetation which will become the nest where they incubate the eggs for 47 to 61 days. The chicks are precocial at hatching, but dependent on their male parents for protection from predators and for teaching them how to find food for themselves. This period will last for about 9 months, when the males will abandon the juvenile cassowaries.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Protecting: Male); pre-weaning/fledging (Provisioning: Male, Protecting: Male); pre-independence (Provisioning: Male, Protecting: Male)

  • 1985. Ostriches and their Relatives - The Ratites. Pp. 19-27 in C Perrins, A Middleton, eds. The Encyclopedia of Birds, Vol. 1, First Edition. New York: Facts on File.
  • 2003. Cassowaries. Pp. 75-81 in J Jackson, W Bock, D Olendorf, eds. Grizmek's Animal Life Encyclopedia, Vol. 8, Second Edition. New York: Thomson Gale.
  • Cohen, J. 2006. "Fact sheets double-wattled cassowary" (On-line). Smithsonian National Zoological Park. Accessed September 12, 2006 at http://nationalzoo.si.edu/Animals/Birds/Facts/FactSheets/fact-cassowary.cfm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Head protected from minor impacts: cassowaries
 

The head of cassowaries may be protected from impact as they traverse dense forest thanks to a foam-like 'helmet' with keratinized covering.

   
  "A casque or helmet composed of a firm foamlike substance with a heavily keratinized covering is located on the top of the head. The purpose of the casque may be to protect the birds when moving head first through dense forest vegetation or may be a social display." (Fowler and Miller 2003:99)

"We recently had an opportunity to dissect an adult male Cassowary found dead near Feluga, in northern Queensland, and found that the casque is neither horny nor bony. The skull does not have a protuberance as might be expected and the casque itself consists of a keratinous skin over a core of firm, cellular foam-like material that looks like some hi-tech plastic. This foam is very resilient and gives the casque elastic properties that appear to be lost in dried museum skins. The casque is very rigid longitudinally but can easily be squeezed and deformed laterally. When pressure is released the casque springs back to shape.

"The casque is usually described as serving to provide protection as the bird moves through thick vegetation. Cassowaries normally move slowly with head and neck erect, but when moving at high speed they stretch the neck out horizontally and run full tilt through the vegetation, brushing saplings aside and occasionally careering into small trees. The casque would help protect the skull from such collisions. There is also the possibility that it has a secondary sexual function. However, both sexes have one, the female's being larger than the male's and I (F.C.) have not seen it being particularly prominent in mating displays or fighting. We believe the foam inside the casque supports the idea that it acts as a protective device - it appears to have excellent shock-absorbing qualities." (Crome and Moore 1988:123)
  Learn more about this functional adaptation.
  • Crome, FHJ; Moore, LA. 1988. The cassowary's casque. Emu. 88(2): 123-124.
  • Fowler, ME; Miller, RE. 2003. Zoo and Wild Animal Medicine. Philadelphia: W.B. Saunders Co.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Communicating over long distances: cassowaries
 

Cassowaries communicate over long distances in dense rainforest using low frequency booming sounds.

     
  "Although some birds can detect wavelengths in the infrasound range, there has been little evidence that birds produce very low frequencies. We made nine recordings of a captive Dwarf Cassowary (Casuarius benneti) and one recording of a wild Southern Cassowary (C. casuarius) near Crater Mountain, Papua New Guinea. Both species produced sounds near the floor of the human hearing range in their pulsed booming notes: down to 32 Hz for C. casuarius and 23 Hz in C. benneti. Recordings of C. benneti indicate four levels of harmonics with the 23 Hz fundamental frequency. Such low frequencies are probably ideal for communication among widely dispersed, solitary cassowaries in dense rainforest. The discovery of very low-frequency communication by cassowaries creates new possibilities for studying those extremely secretive birds and for learning more about the evolution of avian vocalizations." (Mack and Jones 2003:1062)
  Learn more about this functional adaptation.
  • Mack, A. L.; Jones, J. 2003. Low-frequency vocalizations by cassowaries (Casuarius spp.). The Auk. 120(4): 1062-1068.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Casuarius casuarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

GTGACCTTCATTACTCGATGACTATTTTCAACTAACCACAAAGATATCGGCACACTTTACCTCATCTTCGGTGCATGAGCAGGTATGGTGGGCACTGCTCTCAGCCTACTCATCCGTGCCGAACTTGGCCAACCAGGCACACTACTAGGAGACGACCAGATCTACAATGTGATCGTTACCGCCCATGCCTTCGTAATAATTTTCTTCATGGTAATACCTGTAATAATCGGAGGCTTTGGAAACTGACTAGTCCCACTTATAATTGGTGCTCCAGACATAGCATTTCCACGCATAAACAACATAAGCTTTTGACTCCTACCTCCATCCTTCCTATTACTATTAGCATCATCCACAGTTGAAGCAGGGGCAGGAACAGGATGAACAGTATATCCCCCACTAGCTGGGAACCTGGCCCATGCAGGAGCCTCTGTAGATCTTGCCATCTTCTCACTCCACCTAGCTGGTGTTTCCTCCATCCTAGGGGCAATTAATTTTATTACCACCGCAATCAACATGAAACCTCCAGCACTCACACAATACCAAACACCATTATTCGTATGATCCGTATTAATTACCGCTATCCTCCTTCTACTATCACTCCCAGTCCTCGCTGCAGGCATCACCATGCTCCTTACAGACCGAAATCTTAACACCACATTCTTTGACCCTGCTGGAGGAGGAGACCCTGTACTGTATCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTTTACATCTTAATCCTTCCAGGCTTCGGAATAATTTCACATGTAGTAACTTACTACGCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTATGGGCTATACTGTCTATCGGATTCCTAGGCTTTATCGTATGAGCTCACCATATATTTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACATCCGCTACCATAATCATCGCCATTCCAACCGGCATTAAAGTATTTAGCTGATTGGCTACTCTACATGGAGGTACAATCAAGTGGGATCCACCCATTCTATGAGCCTTAGGCTTTATTTTCCTATTCACTATCGGTGGCCTAACCGGTATTGTACTAGCAAACTCCTCCCTGGACATCGCCCTACATGATACATACTATGTAGTAGCCCACTTCCACTATGTTCTCTCAATAGGAGCTGTCTTTGCCATCCTAGCAGGTTTCACACACTGATTCCCCTTATTTACTGGATACACCCTTCATCCAACCTGAGCAAAAGCTCACTTCGGGGTTATATTTACAGGAGTAAATCTAACCTTCTTCCCACAACACTTCTTAGGTCTAGCTGGAATGCCACGACGATACTCAGACTACCCAGATGCCTACACCTTATGAAACACCCTATCGTCTATCGGCTCCCTAATCTCCATAACAGCTGTAATTATATTAATATTCATCATCTGAGAAGCATTCTCCTCAAAACGAAAAGTAGCTCAACCAGAACTAATTGCAACCAATATTGAATGAATCCATGGCTGCCCACCCCCACACCATACCTTTGAGGAACCAGCCTATGTTCAAGTGCAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Casuarius casuarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cde

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Bishop, K., Westcott, D., Garnett, S. & Dutson, G.

Justification
This species is believed to have undergone a rapid decline in the last three generations (44 years) in Australia, and declines of a similar magnitude elsewhere in its range are possible, with local extirpations reported from parts of New Guinea. It is therefore classified as Vulnerable. However, the decline in Australia resulted from an extraordinary rate of habitat destruction which has virtually ceased. Further information from New Guinea may indicate that the species would be better listed as Near Threatened if hunting and high-impact industrial logging does not increase in the large areas of existing habitat there.


History
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Vulnerable (VU)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5