Overview

Brief Summary

Description

Cassowaries are large, flightless birds that are related to emus and found only in Australia and New Guinea (2). The southern cassowary has a glossy black plumage and a bright blue neck, with red colouring at the nape (3). Two wattles of bare, red coloured skin hang down from the throat. Cassowaries have stout, powerful legs and long feet with 3 toes; the inner toe on each foot has a sharp claw that can reach up to 80 millimetres in length (4). The name cassowary comes from a Papuan name meaning 'horned head', referring to the helmet of tough skin born on the crown of the head. This helmet (or casque) slopes backwards and is used to push through vegetation as the cassowary runs through the rainforest with its head down; it also reflects age and dominance. The sexes are similar in appearance although females tend to be larger and heavier. Chicks are striped black and cream; fading to brown after around five months. The adult colouring and casque begin to develop between two and four years of age (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Cassowaries are usually solitary individuals, and males are subordinate to females if they meet. Females may lay several clutches of eggs during the breeding season that runs from June to October. These are laid directly onto the forest floor and the male then takes sole responsibility for their care. The male incubates the eggs for around 50 days, turning the eggs and only leaving his charges in order to drink. He cares for his offspring for up to 16 months, protecting them under his tail if threatened (4). Cassowaries fight by kicking out with their legs, they have a fearsome reputation but their diet is composed almost entirely of fruit. These birds are important dispersers of a number of rainforest seeds, ranging far in search of fruiting trees (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range Description

Casuarius casuarius is found in New Guinea (Papua, formerly Irian Jaya, Indonesia and Papua New Guinea), including the islands of Seram (where probably introduced) and Aru, and north-eastern Australia. It occurs throughout the lowlands of New Guinea except for the northern watershed from the Vogelkop to the Huon Peninsula (Coates 1985, Beehler et al. 1986). In Papua and adjacent islands, its status is unclear, but it may be more common than in Papua New Guinea. In Papua New Guinea, it has declined, and is now absent in some locations, including remote areas (Coates 1985, K. D. Bishop in litt. 1999). In Australia, there are 3 subpopulations in Queensland. The southern and largest population ranges from the Paluma Range north of Townsville to Mt Amos. Two populations occur further north on Cape York Peninsula: one in the McIlwraith Range and north to the Pascoe River, the other in the Jardine River National Park and Heathland Resources Reserve (Kofron and Chapman 2006). The Australian population was estimated to number c. 2,500 birds in 2010, but it is declining (Garnett et al. 2011).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

Humid forests of ne Australia, New Guinea and Aru Islands.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Southern cassowaries are found in New Guinea, Cape York, Ceram and Aru Islands.

Biogeographic Regions: australian (Introduced , Native ); oceanic islands (Introduced , Native )

Other Geographic Terms: island endemic

  • 2003. Cassowaries. Pp. 75-81 in J Jackson, W Bock, D Olendorf, eds. Grizmek's Animal Life Encyclopedia, Vol. 8, Second Edition. New York: Thomson Gale.
  • 1985. Ostriches and their Relatives - The Ratites. Pp. 19-27 in C Perrins, A Middleton, eds. The Encyclopedia of Birds, Vol. 1, First Edition. New York: Facts on File.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The southern cassowary is found in New Guinea as well as Queensland in northeastern Australia (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Southern cassowaries are large, robust birds with long powerful legs for running and defense; the claws on the toes are up to 12 cm long. Their bodies are covered with dark brown or black feathers which look more like thick, coarse hair. The neck and head have no feathers and are boldly colored blue and red. On their heads there is a large bony casque which is made of trabecular bone and cartilage. The wings are extremely small and there are vestiges of primary feathers in the form of five or six long white spines. Cassowary chicks are brown with black stripes running the length of their bodies for their first three to six months. Juveniles are brown instead of black and have smaller casques. They do not get the vividly colored necks until they are about one year old. Females are 127 to 170 cm long and up to 59 kg, are larger than the males which are 29 to 34 kg. Southern cassowaries are the largest of the three species of cassowary and the only species to have have two bright red flaps of skin, called wattles, hanging from their neck.

Range mass: 29 to 59 kg.

Range length: 102 to 170 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
It is a solitary and sedentary inhabitant of rainforest, occasionally using adjacent savannah forests, mangroves and fruit plantations. Its diet largely comprises fallen fruit, although it is fairly undiscriminating (Garnett et al. 2011). It ranges between 0 m and at least 500 m in Papua New Guinea (Johnson et al. 2004), and has been recorded up to 1,400 m in Australia.


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Southern cassowaries live primarily in lowland rainforests, typically less than 1,100 meters elevation, and occasionally are found in eucalyptus forests, savannas, palm scrub, and in forested swamps.

Range elevation: 0 to 1,100 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

  • Barrett, N. 1991. Flightless Birds. New York: Franklin Watts.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These birds are rainforest inhabitants, although they are also found in nearby savannah, mangroves and fruit plantations (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Southern cassowaries are frugivorous, feeding mostly on fruits from canopy species in the forests where they live. Because these birds cannot fly they must rely on finding fruit that has fallen to the ground. They also eat insects, small vertebrates, and fungi. Inspection of the feces reveals that commonly ingested fruits are Davidsonia pruriens, Acemena divaricata and members of the laurel family (Lauraceae).

Animal Foods: mammals; amphibians; reptiles; insects; terrestrial non-insect arthropods

Plant Foods: fruit

Other Foods: fungus

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Cassowaries live primarily on fruit from a large number of species of trees. When cassowaries eat the fruit the seeds pass through their system and are dispersed far from where they originally fell. The seeds are often still viable after passing through the digestive system of cassowaries. In a typical pile of cassowary dung there can be as much as one kilogram of seeds. In a study of the effects of seed dispersal by cassowaries, the seeds from 78 species of plants were found and 70 of these species' seeds were able to germinate after being passed through the cassowaries. Some of the species found in cassowaries dung include Davidsonia pruriens, Acemena divaricata, Polyalthia michaelii, Acronychia acronychioides and a large number from the Lauraceae family.

Ecosystem Impact: disperses seeds

Mutualist Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

It is unknown whether cassowaries have any natural predators, but humans could be considered a predator because cassowaries are sometimes eaten by humans.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Southern cassowaries communicate with each other by issuing very loud deep roars which travel well through the forest. These roars are up to 40 decibels louder than the surrounding forest noise, and are at frequencies which are at the very bottom end of what humans can perceive, about 23 Hertz. Cassowaries are one of the only birds to have been recorded making vocalizations this low. There is some speculation about whether the casques on their heads are somehow related to these impressive sounds. It is speculated that the casque could play a role in receiving or producing these sounds. These calls are territorial, warning other cassowaries of their presence.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

There is little known about the lifespan of southern cassowaries in the wild, but in captivity southern cassowaries have lived 20 to 40 years.

Range lifespan

Status: captivity:
20 to 40 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Females are polyandrous; a female will usually breed with two to three males throughout the mating season, starting a new nest every time, which the male will incubate. Courtship consists of the males making a “boo-boo-boo” call while inflating his throat.

Mating System: polyandrous

The breeding season is in winter, when fruit is most abundant. The nest is a pad of vegetation on the ground and there are typically about 4 bright green eggs in a clutch. Incubation, which is exclusively done by the males, lasts for 47 to 61 days. Once the chicks hatch they stay with their father until they become independent at about nine months. At about three years of age, southern cassowaries are able to reproduce.

Breeding interval: Females will mate with 2 to 3 males during the mating season.

Breeding season: Breeding occurs during the austral winter, from June to July.

Range eggs per season: 4 to 8.

Range time to hatching: 47 to 61 days.

Average time to independence: 9 months.

Average age at sexual or reproductive maturity (female): 3 years.

Average age at sexual or reproductive maturity (male): 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

After the eggs are laid all care of the eggs and offspring are done by males. Males construct a mat of vegetation which will become the nest where they incubate the eggs for 47 to 61 days. The chicks are precocial at hatching, but dependent on their male parents for protection from predators and for teaching them how to find food for themselves. This period will last for about 9 months, when the males will abandon the juvenile cassowaries.

Parental Investment: precocial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Protecting: Male); pre-weaning/fledging (Provisioning: Male, Protecting: Male); pre-independence (Provisioning: Male, Protecting: Male)

  • 2003. Cassowaries. Pp. 75-81 in J Jackson, W Bock, D Olendorf, eds. Grizmek's Animal Life Encyclopedia, Vol. 8, Second Edition. New York: Thomson Gale.
  • 1985. Ostriches and their Relatives - The Ratites. Pp. 19-27 in C Perrins, A Middleton, eds. The Encyclopedia of Birds, Vol. 1, First Edition. New York: Facts on File.
  • Cohen, J. 2006. "Fact sheets double-wattled cassowary" (On-line). Smithsonian National Zoological Park. Accessed September 12, 2006 at http://nationalzoo.si.edu/Animals/Birds/Facts/FactSheets/fact-cassowary.cfm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Head protected from minor impacts: cassowaries
 

The head of cassowaries may be protected from impact as they traverse dense forest thanks to a foam-like 'helmet' with keratinized covering.

   
  "A casque or helmet composed of a firm foamlike substance with a heavily keratinized covering is located on the top of the head. The purpose of the casque may be to protect the birds when moving head first through dense forest vegetation or may be a social display." (Fowler and Miller 2003:99)

"We recently had an opportunity to dissect an adult male Cassowary found dead near Feluga, in northern Queensland, and found that the casque is neither horny nor bony. The skull does not have a protuberance as might be expected and the casque itself consists of a keratinous skin over a core of firm, cellular foam-like material that looks like some hi-tech plastic. This foam is very resilient and gives the casque elastic properties that appear to be lost in dried museum skins. The casque is very rigid longitudinally but can easily be squeezed and deformed laterally. When pressure is released the casque springs back to shape.

"The casque is usually described as serving to provide protection as the bird moves through thick vegetation. Cassowaries normally move slowly with head and neck erect, but when moving at high speed they stretch the neck out horizontally and run full tilt through the vegetation, brushing saplings aside and occasionally careering into small trees. The casque would help protect the skull from such collisions. There is also the possibility that it has a secondary sexual function. However, both sexes have one, the female's being larger than the male's and I (F.C.) have not seen it being particularly prominent in mating displays or fighting. We believe the foam inside the casque supports the idea that it acts as a protective device - it appears to have excellent shock-absorbing qualities." (Crome and Moore 1988:123)
  Learn more about this functional adaptation.
  • Fowler, ME; Miller, RE. 2003. Zoo and Wild Animal Medicine. Philadelphia: W.B. Saunders Co.
  • Crome, FHJ; Moore, LA. 1988. The cassowary's casque. Emu. 88(2): 123-124.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Functional adaptation

Communicating over long distances: cassowaries
 

Cassowaries communicate over long distances in dense rainforest using low frequency booming sounds.

     
  "Although some birds can detect wavelengths in the infrasound range, there has been little evidence that birds produce very low frequencies. We made nine recordings of a captive Dwarf Cassowary (Casuarius benneti) and one recording of a wild Southern Cassowary (C. casuarius) near Crater Mountain, Papua New Guinea. Both species produced sounds near the floor of the human hearing range in their pulsed booming notes: down to 32 Hz for C. casuarius and 23 Hz in C. benneti. Recordings of C. benneti indicate four levels of harmonics with the 23 Hz fundamental frequency. Such low frequencies are probably ideal for communication among widely dispersed, solitary cassowaries in dense rainforest. The discovery of very low-frequency communication by cassowaries creates new possibilities for studying those extremely secretive birds and for learning more about the evolution of avian vocalizations." (Mack and Jones 2003:1062)
  Learn more about this functional adaptation.
  • Mack, A. L.; Jones, J. 2003. Low-frequency vocalizations by cassowaries (Casuarius spp.). The Auk. 120(4): 1062-1068.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Casuarius casuarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

GTGACCTTCATTACTCGATGACTATTTTCAACTAACCACAAAGATATCGGCACACTTTACCTCATCTTCGGTGCATGAGCAGGTATGGTGGGCACTGCTCTCAGCCTACTCATCCGTGCCGAACTTGGCCAACCAGGCACACTACTAGGAGACGACCAGATCTACAATGTGATCGTTACCGCCCATGCCTTCGTAATAATTTTCTTCATGGTAATACCTGTAATAATCGGAGGCTTTGGAAACTGACTAGTCCCACTTATAATTGGTGCTCCAGACATAGCATTTCCACGCATAAACAACATAAGCTTTTGACTCCTACCTCCATCCTTCCTATTACTATTAGCATCATCCACAGTTGAAGCAGGGGCAGGAACAGGATGAACAGTATATCCCCCACTAGCTGGGAACCTGGCCCATGCAGGAGCCTCTGTAGATCTTGCCATCTTCTCACTCCACCTAGCTGGTGTTTCCTCCATCCTAGGGGCAATTAATTTTATTACCACCGCAATCAACATGAAACCTCCAGCACTCACACAATACCAAACACCATTATTCGTATGATCCGTATTAATTACCGCTATCCTCCTTCTACTATCACTCCCAGTCCTCGCTGCAGGCATCACCATGCTCCTTACAGACCGAAATCTTAACACCACATTCTTTGACCCTGCTGGAGGAGGAGACCCTGTACTGTATCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTTTACATCTTAATCCTTCCAGGCTTCGGAATAATTTCACATGTAGTAACTTACTACGCAGGAAAAAAAGAACCATTCGGATATATAGGAATAGTATGGGCTATACTGTCTATCGGATTCCTAGGCTTTATCGTATGAGCTCACCATATATTTACAGTAGGAATAGATGTAGATACCCGAGCTTATTTTACATCCGCTACCATAATCATCGCCATTCCAACCGGCATTAAAGTATTTAGCTGATTGGCTACTCTACATGGAGGTACAATCAAGTGGGATCCACCCATTCTATGAGCCTTAGGCTTTATTTTCCTATTCACTATCGGTGGCCTAACCGGTATTGTACTAGCAAACTCCTCCCTGGACATCGCCCTACATGATACATACTATGTAGTAGCCCACTTCCACTATGTTCTCTCAATAGGAGCTGTCTTTGCCATCCTAGCAGGTTTCACACACTGATTCCCCTTATTTACTGGATACACCCTTCATCCAACCTGAGCAAAAGCTCACTTCGGGGTTATATTTACAGGAGTAAATCTAACCTTCTTCCCACAACACTTCTTAGGTCTAGCTGGAATGCCACGACGATACTCAGACTACCCAGATGCCTACACCTTATGAAACACCCTATCGTCTATCGGCTCCCTAATCTCCATAACAGCTGTAATTATATTAATATTCATCATCTGAGAAGCATTCTCCTCAAAACGAAAAGTAGCTCAACCAGAACTAATTGCAACCAATATTGAATGAATCCATGGCTGCCCACCCCCACACCATACCTTTGAGGAACCAGCCTATGTTCAAGTGCAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Casuarius casuarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A2cde

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s
Bishop, K., Westcott, D., Garnett, S. & Dutson, G.

Justification
This species is believed to have undergone a rapid decline in the last three generations (44 years) in Australia, and declines of a similar magnitude elsewhere in its range are possible, with local extirpations reported from parts of New Guinea. It is therefore classified as Vulnerable. However, the decline in Australia resulted from an extraordinary rate of habitat destruction which has virtually ceased. Further information from New Guinea may indicate that the species would be better listed as Near Threatened if hunting and high-impact industrial logging does not increase in the large areas of existing habitat there.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The biggest threat to southern cassowaries is the destruction of their habitat. These birds are also sometimes killed by cars and their populations are disrupted by feral pigs and dogs. There has been a 30% decline in their numbers in the last 30 years. Fortunately, in Australia, the destruction of habitat has almost completely stopped and in New Guinea there are large areas where the bird is not hunted which helps their numbers. Southern cassowaries will be safe as long as there are large areas of undisturbed forests.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: vulnerable

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Vulnerable (VU) on the IUCN Red List 2007 (1).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
No data are available for New Guinea. Garnett et al. (2011) estimated the Australian population to number 2,500 mature individuals. As such, the total population is best placed in the band 10,000-19,999 individuals, equating to 6,667-13,333 mature individuals, rounded here to 6,000-15,000 mature individuals.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
In Australia, it was historically threatened by habitat loss and fragmentation. In Indonesia and Papua New Guinea, the species is heavily hunted, captured and traded close to populated areas, being of high cultural importance, and constituting a major food source for subsistence communities (Coates 1985, Beehler et al. 1986, K. D. Bishop in litt. 1999). This hunting and trade is not sustainable in many areas and has led to its extirpation from some sites, as the species is traded at a sub-national level to supply markets in more densely populated areas (Johnson et al. 2004). Increasing human populations and the spread of shotguns used for hunting exacerbate hunting pressure on the species. However, although birds appear to be more common in unpopulated areas (Beehler et al. 1994, Burrows 1995), they can apparently survive in some hunted areas (Beehler 1985), probably those where traditional hunting techniques predominate. Industrial logging is threatening large areas of suitable habitat in New Guinea, with unknown but potentially significant impact on the species, and clearance for oil-palm plantations is a significant but unquantified threat. Cyclones are considered a threat to the species in Australia, with cyclones severely affecting Cassowary habitat in 2006 and 2011. In 2006, Cyclone Larry hit Queensland, affecting fruit production in tropical rain forests and causing the death of some cassowaries, either directly or as a result of starvation and exposure to other threats following the cyclone. In addition, following the cyclone some individuals could have ventured beyond forest fragments and may have suffered higher mortality through collisions with motor vehicles or attacks by dogs (L. A. Moore & N. J. Moore unpub. data to Bellingham 2008). Increased susceptibility to disease (e.g. tuberculosis) following such events may pose a threat to the species (Cooper 2008), although this is yet to be confirmed. Climate change could increase the severity of cyclones in the future. It should be noted, however, that even large cyclones have a severe effect on only a small proportion of cassowary habitat.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The destruction of rainforest and wet tropical coastal lowland habitat is the most important cause of the decline in population numbers of the southern cassowary. As forest is cleared to make way for agriculture or development, populations become fragmented and isolated, reducing genetic variation and where they may not have access to sufficient food or water sources. Traffic accidents are also important causes of mortality, particularly in Queensland where some areas are becoming increasingly populated. Where cassowaries come into contact with humans, dogs pose a threat to survival, preying particularly on young birds. In New Guinea, cassowaries are important food sources for some communities and are heavily hunted as a result (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
A recovery plan for the species in Australia was published in 2002 (Queensland Parks and Wildlife Service 2002) and updated in 2007 (Latch 2007). In Australia, programmes have been aimed at community education, localised habitat management, protection and revegetation, management plans for populations and high-risk individuals, surveys, survey and translocation methods, and habitat use. Temporary feeding stations have been installed in damaged areas following cyclones in Australia. Most remaining habitat is within protected areas (Westcott 1999, D. Westcott in litt. 1999, Garnett et al. 2011). A village based survey has been conducted in Papua New Guinea investigating sustainability of wildlife capture and trade (Johnson et al. 2004).

Conservation Actions Proposed
Quantify forest loss in New Guinea. Determine population densities, sizes and demographic trends throughout its range. In Indonesia and Papua New Guinea: Monitor populations in protected areas. Quantify the effects of hunting and logging. Promote community-based hunting restrictions. In Australia: Revise monitoring techniques and monitor key sites. Research population dynamics. Research impact of cyclones, dogs, traffic, disease and fragmentation on persistence of small populations and on survivorship and demography. Prevent habitat clearance. Minimise cassowary road deaths and dog attacks, and assess impact of pigs. Undertake dog and pig control areas of in dense populations (Garnett et al. 2011). Investigate the feasibility and merits and, if appropriate, implement a translocation plan as part of rescue, rehabilitation and release. Identify areas and corridors to protect, restore, manage, develop and implement Cassowary Conservation Local Area Plans as part of local planning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

In Australia most of the remaining habitat of the southern cassowary is now located within protected areas (3). A recovery plan for the species has been drawn up by the Queensland Parks and Wildlife Service with the aim of securing and enhancing the status of the southern cassowary in Australia through integrated conservation initiatives (5). In New Guinea, further data on population numbers is required and hunting restrictions may need to be imposed (3). This awesome bird belongs to an ancient lineage and is one of the most striking of the flightless birds; its conservation has important cultural and ecological significance.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although they are usually shy, southern cassowaries can be aggressive towards people, especially when kept in captivity. Southern cassowaries will charge people, jumping at them while slashing with their 12 cm claws. They can cause serious injury and sometimes death. In 2004 southern cassowaries were voted by the Guinness Book of World Records as the worlds most dangerous bird for these reasons.

Negative Impacts: injures humans

  • Folkard, C. 2004. Guinness Book of World Records, 2004. New York: Turtleback Books.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Southern cassowaries are important in the mythology of the indigenous peoples of New Guinea and Australia. These birds are captured as chicks and raised in villages so that their feathers can plucked and used in headdresses and the quills can be used as nose ornaments. Eventually, when the birds reach a certain size they are killed for food. There has been a trade of cassowaries in Southeast Asia for over 500 years. It is possible that populations of southern cassowaries on Australia and some of the islands surrounding New Guinea are the result of human introductions through trade.

Positive Impacts: food ; body parts are source of valuable material

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Southern Cassowary

The Southern Cassowary (Casuarius casuarius) also known as Double-wattled Cassowary, Australian Cassowary or Two-wattled Cassowary,[2] is a large flightless black bird. It is a ratite and therefore related to the Emu, Ostrich, and the genus Rhea. (See also Dwarf Cassowary and Northern Cassowary.)

Description[edit]

Detail of feet showing spearlike inner claw

It has stiff, bristly black plumage, a blue face and neck, red on the nape and two red wattles measuring around 17.8 cm (7.0 in) in length hanging down around its throat.[2] A horn-like brown casque, measuring 13 to 16.9 cm (5.1 to 6.7 in) high, sits atop the head.[2] The bill can range from 9.8 to 19 cm (3.9 to 7.5 in).[2] The three-toed feet are thick and powerful, equipped with a lethal dagger-like claw up to 12 cm (4.7 in) on the inner toe.[2] The plumage is sexually monomorphic, but the female is dominant and larger with a longer casque, larger bill and brighter-colored bare parts. The juveniles have brown longitudinal striped plumage. It is the largest member of the cassowary family and is the second heaviest bird on earth, at a maximum size estimated at 85 kg (187 lb) and 190 cm (75 in) tall. Normally this species ranges from 127–170 cm (50–67 in) in length. The height is normally 1.5–1.8 m (4.9–5.9 ft)[2][3] and females average 58.5 kg (129 lb) and males averaging 29–34 kg (64–75 lb).[2][4] Most adult birds will weigh between 17 and 70 kg (37 and 154 lb).[5] It is technically the largest Asian bird (since the extinction of the Arabian Ostrich, and previously the Moa of New Zealand) and the largest Australian bird (though the Emu may be slightly taller).

Range and habitat[edit]

The Southern Cassowary is distributed in tropical rainforests of Indonesia, New Guinea and northeastern Australia,[6] and it prefers elevations below 1,100 m (3,600 ft) in Australia,[2] and 500 m (1,600 ft) on New Guinea.[7]

Breeding Population and Trends[7]
LocationPopulationTrend
Southern Papua New GuineaunknownDeclining
SeramUnknownUnknown
Aru IslandsUnknownUnknown
Northeastern Australia1,500 to 2,500Declining
**Paluma RangeUnknownDeclining
**McIlwraith Range1000+Declining
**Jardine River National ParkUnknownUnknown
Total2,500+Declining

Behaviour[edit]

It forages on the forest floor for fallen fruit and is capable of safely digesting some fruits toxic to other animals. They also eat fungi, and some insects and small vertebrates. The Southern Cassowary is a solitary bird, that pairs only in breeding season, which takes place in late winter or spring. The male builds a nest on the ground;[2] a mattress of herbaceous plant material 5 to 10 centimetres (2–4 in) thick and up to 100 centimetres (39 in) wide. This is thick enough to let moisture drain away from the eggs. The male also incubates the eggs and raises the chicks alone. A clutch of three or four eggs are laid measuring 138 by 95 millimetres (5.4 in × 3.7 in). They have a granulated surface and are initially bright pea-green in colour although they fade with age.[2][8]

They make a booming call during mating season and hissing and rumblings otherwise. Chicks will make frequent high-pitches whistles to call the male.[7]

The blade-like claws are capable of killing humans and dogs if the bird is provoked.

Conservation[edit]

Adult male with two chicks at Artis Zoo, Netherlands
Chick at Artis Zoo, Netherlands
An older juvenile walking across a road in Australia

Due to ongoing habitat loss, limited range, and overhunting in some areas, the Southern Cassowary is evaluated as Vulnerable on the IUCN Red List of Threatened Species.[1] The Australian population is listed as Endangered under Federal and Queensland State legislation.[citation needed] Some threats are through habitat loss (logging), feral animals eating their eggs, hunting, and roadkill.[1][2] Road building, feral animals and hunting are the worst of these threats. It has an occurrence range of 396,000 km2 (153,000 sq mi), and between 10,000 and 20,000 birds were estimated in a 2002 study, with between 1,500 and 2,500 in Australia.[7] There are occurrences of southern cassowaries being bred outside of Australia in captivity, like at White Oak Conservation in Yulee, Florida, United States.[9]

Taxonomy[edit]

Upper body

Presently, most authorities consider the Southern Cassowary monotypic, but several subspecies have been described.[10] It has proven very difficult to confirm the validity of these due to individual variations, age-related variations, the relatively few available specimens (and the bright skin of the head and neck – the basis of which several subspecies have been described – fades in specimens), and that locals are known to have traded live cassowaries for hundreds, if not thousands, of years, some of which are likely to have escaped/been deliberately introduced to regions away from their origin.[10]

Cassowaries, of the family Casuariidae, are closely related to the kiwis in the family Apterygidae, with these two bird families diverging from a common ancestor 40 million years ago. The Southern Cassowary is in the class Aves, which includes all birds; those that can fly as well as those that cannot.

Their binomial name Casuarius casuarius is derived from the Malay word kesuari, meaning cassowary.[11] The Southern Cassowary was first described by Carolus Linnaeus in his 18th century work, Systema Naturae, as Struthio casuarius,[12] from a specimen from Seram, in 1758.[2] It is now the type species of the genus Casuarius.[2]

Footnotes[edit]

  1. ^ a b c BirdLife International (2012). "Casuarius casuarius". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h i j k l m n Davies, S. J. J. F. (2003)
  3. ^ Buzzle.com
  4. ^ Animal Life Resource
  5. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  6. ^ Clements, J (2007)
  7. ^ a b c d BirdLife International (2008)
  8. ^ Beruldsen, G (2003)
  9. ^ "Double-Wattled Cassowary". Retrieved 21 June 2013. 
  10. ^ a b Davies, S. J. J. F. (2002)
  11. ^ Gotch, A. F. (1995)
  12. ^ Linnaeus, C (1758)

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!