Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

Geographic Range

Pulsatrix perspicillata can be found from Southern Mexico through Argentina. It can also be found on Carribean islands such as Trinidad.

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Spectacled owls are characterized by white "spectacles" around their bright yellow eyes. They have dark brown plumage on their upper parts and off-white or light yellow plumage on their breast. They have a thin white stripe around the throat with a thick dark brown stripe below. Coloration is reversed in juveniles; they are mostly white with a brown/black facial disk.

Spectacled owls are 43 to 46 cm long, males weigh 453 to 680 g and females weigh 680 to 906 g. Their wingpans are from 0.762 to 0.914 m.

Range mass: 453 to 906 g.

Range length: 43 to 46 cm.

Range wingspan: 0.762 to 0.914 m.

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spectacled owls live near water in rainforest and woodlands. They can be found from sea level to elevations of 1600 m.

Range elevation: 0 to 1600 m.

Habitat Regions: temperate ; tropical

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Spectacled owls are very fast, and once they spot their prey they will swoop down, snatch up the prey, and return to their perch. They will also glean insects from vegetation. They are carnivorous and mostly eat mice and insects. They are also known to eat crabs, bats, possums, skunks, frogs and smaller birds no larger than a blue jay. They usually hunt at night, but will occasionally hunt during the day.

Animal Foods: birds; mammals; amphibians; insects; terrestrial non-insect arthropods

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Spectacled owls are important members of their ecosystem; because of their food habits they likely have a regulatory influence on insect and mammal populations, and they are an important food source for their predators.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Because spectacled owls hide in foliage that hangs low, they are not easily detected by predators. They are sometimes preyed upon by larger birds (class Aves).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Pulsatrix perspicillata is prey of:
Aves

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Pulsatrix perspicillata preys on:
Arthropoda
Insecta
Amphibia
Aves
Mammalia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Males have a distinct call that sounds like a hammer hitting a hollow tree repeatedly; the sound descends in volume. Females have a loud screeching call used mostly to attract males during the mating season.

Communication Channels: acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Cycle

Development

The incubation period of an embryo is from 6-8 months. Juveniles leave the nest before they are able to fly, but frequently return to eat. They go through almost five years of molting before they attain their adult plummage when in captivity.In the wild they may molt within three years.They attempt to fly within two years. Yet only after the long molting period can they fly efficiently.(Burton, 1984)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

With very few predators, this species can live up to 35 years in the wild. They are known to live for 25 to 30 years in captivity.

Range lifespan

Status: wild:
35 (high) years.

Range lifespan

Status: captivity:
25 to 30 years.

Average lifespan

Status: captivity:
25 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 25 years (captivity) Observations: These animals have been reported to live up to 25 years in captivity (http://www.zoo.org/).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Spectacled owls are monogamous.

Mating System: monogamous

Breeding occurs in the dry season or the beginning of the wet season (April to June or September to October depending on location). They build their nests inside tree cavities. Females lay a maximum of two eggs and often only one chick will survive. Young fledge after 5 to 6 weeks; they are often dependent on their parents for up to a year. Spectacled owls reach maturity in 3 to 5 years.

Breeding season: Breeding occurs in the dry season or the beginning of the wet season.

Range eggs per season: 1 to 2.

Range age at sexual or reproductive maturity (female): 3 to 5 years.

Range age at sexual or reproductive maturity (male): 3 to 5 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Average time to hatching: 36 days.

Average eggs per season: 2.

Both the male and female assist in raising young, but most of the responsiblity rests on the female. They each take turns sitting on the eggs while the other goes out to hunt. The chicks leave the nest before they can fly and often remain with their parents for a year after fledging.

Parental Investment: no parental involvement; altricial ; pre-fertilization; pre-hatching/birth (Protecting: Male, Female); pre-weaning/fledging (Provisioning); pre-independence (Provisioning)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pulsatrix perspicillata

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTAATCTTCGGTGCATGAGCTGGCATAGTCGGTACAGCCCTAAGCCTACTTATCCGAGCCGAACTAGGTCAACCCGGAACACTCCTAGGTGACGATCAAATCTACAATGTGATTGTCACCGCCCATGCCTTTGTAATAATCTTCTTCATAGTTATACCAATCATGATCGGAGGATTTGGTAACTGACTAGTACCATTAATAATCGGAGCTCCAGACATAGCCTTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCACCCTCCTTCCTACTCTTACTAGCTTCTTCCACAGTAGAAGCCGGAGCAGGCACCGGATGGACTGTCTACCCACCACTAGCCAGCAACCTAGCCCATGCTGGAGCCTCAGTAGACCTTACCATCTTCTCCCTTCACCTAGCTGGAGTATCCTCTATCCTAGGGGCAATCAACTTCATCACTACCGCTATCAACATAAAACCCCCCTCCCTATCACAGTACCAAACCCCCCTATTCGTTTGATCCGTCCTCATCACCGCCATTCTCCTACTACTATCCCTCCCAGTCCTTGCCGCAGGTATTACCATACTGCTAACTGACCGCAACCTAAACACCACATTCTTCGACCCCGCCGGCGGAGGCGACCCGATCCTGTACCAGCACCTTTTCTGATTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Pulsatrix perspicillata

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Spectacled owls are listed under Appendix II by CITES but have not been evlauated by the IUCN. They could become severely threatened if rainforests and other forested areas in South America continue to be cut down for agriculture and lumber industries.

There have already been efforts to conserve spectacled owls. Many are bred in captivity and released in the wild, while others are kept in zoos and conservatories.

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight (A. Panjabi in litt. 2008)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of spectacled owls on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Spectacled owls help eliminate pests species, such as insects and mice that can destroy crops.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Spectacled Owl

The Spectacled Owl, Pulsatrix perspicillata, is a large tropical owl. It is a resident breeder from southern Mexico and Trinidad, through Central America, south to southern Brazil, Paraguay and northwestern Argentina.[1] There are six subspecies.[2]

Contents

Distribution

The Spectacled Owl is found in Mexico, Central America (Belize, Guatemala, El Salvador, Honduras, Nicaragua, Costa Rica, Panama), Trinidad and Tobago, and South America (Colombia; Venezuela, Suriname, French Guiana, Guyana, Paraguay, Ecuador, Peru, Bolivia, Brazil, Argentina).[1]

Description

The Spectacled Owl is can range from 43 to 52 cm (17 to 20 in) in length. Mass in males can range from 453 to 700 g (1.00 to 1.5 lb), whereas females can weigh from 680 to 1,000 g (1.5 to 2.2 lb).[3] It is unmistakable with brown upperparts, head and upper breast, white facial markings and whitish to yellowish-ochre underparts. The eyes are yellow and the beak is pale. The juvenile is even more distinctive than the adult, being completely white apart from a chocolate brown facial disc. Of the six subspecies, only the nominate and P. p. saturata are well described. P. p. saturata differs from the typical Spectacled Owl only in that it is black on the head and the back, with black barring on the sides.[4]

The primary sound made by the Spectacled Owl consists of knocking or tapping sounds with a popping effect: PUP-pup-pup-pup-po or BOO Boo boo boo boo. Each progressive note becomes weaker but faster as the call continues. Females also make a hawk-like scream, ker-WHEEER, which has often been compared to a steam-whistle.

Habitat

The Spectacled Owl is primarily a bird of tropical rain forests, being found mostly in areas where dense, old-growth forest is profuse. However, it may enter secondary habitats, such as forest edges, especially while hunting. On occasion, they have been found in dry forests, treed savanna plains, plantations and semi-open areas with trees.

Behaviour

This species is largely nocturnal, starting activity right around the time of last light at dusk and usually being back on their roosts for the day around first light. It is a solitary, unsocial bird, usually roosting singly each day and only peaceable associating with others of their own species for reproductive purposes.

The Spectacled Owl is typical the largest and most dominant owl in its range, with the larger Great Horned Owl rarely venturing into true rainforest habitats. Most hunting starts with the owl perched on a branch and scanning the area, then dropping with a quick pounce when prey is located. It preys principally on a wide array of mammals, eating almost anything type that is nocturnally active. Various rodents may be primary but other mammals preyed on have included opposums and skunks.[4] Prey species can be heavier than the predating owl, weigh over 1.5 kg (3.3 lb) as in Didelphis opossums, and even the much larger three-toed sloth has been reported to have been killed.[5] Invertebrates are eaten regularly as well, mainly caterpillars, but also crabs, snails, large insects and spiders.[4] Insects may be gleaned directly from foliage while the large owls actively forage. Birds are also taken, including species, such as jays and pigeons, which are taken off of their nocturnal perches and smaller types of owl.[4]

In Costa Rica, eggs are laid variously in the dry season (November–May), or at the start of the wet season (June–July). This owl typically nests in an unlined tree cavity. Spectacled Owls lay 1-2 eggs, which are incubated by the female for about 5 weeks. Chicks leave the nest for surrounding branches at about 5–6 weeks, well before they can fly, but depend on their parents for up to a year once fledged. Often, only one of the chicks will survive.

Subspecies

The following subspecies are currently recognized:[2]

References

  1. ^ a b c BirdLife International (2012). "Pulsatrix perspicillata". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106002257. Retrieved 16 July 2012.
  2. ^ a b "Pulsatrix perspicillata". Integrated Taxonomic Information System. http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=555442. Retrieved 31 October 2011.
  3. ^ Burnie D and Wilson DE (Eds.), Animal: The Definitive Visual Guide to the World's Wildlife. DK Adult (2005), ISBN 0789477645
  4. ^ a b c d Owls of the World by Konig, Weick & Becking. Yale University Press (2009), ISBN 0300142277
  5. ^ "Wild sloth killed by small spectacled owl in Panama". BBC News.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!