Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

Geographic Range

Commonly known as little owls, Athene noctua is found within 84 countries of the Palearctic region and the northeastern portion of the Ethiopian region. The range of Athene noctua extends north to the 56th parallel and south to the southern border of the Palearctic region in Asia. The southern extent includes the Middle East to southern Ethiopia and south of western Europe to northern Niger. The eastern limit of the range borders the Sea of Okhotsk and the western limit is found along the Atlantic Ocean.

Biogeographic Regions: palearctic (Native ); ethiopian (Native )

  • Johnson, D., D. Van Nieuwenhuyse, J. Génot. 2009. Survey protocol for the little owl Athene noctua. Ardea, 97/4: 403-412.
  • Van Nieuwenhuyse, D., J. Genot, D. Johnson. 2008. The Little Owl: Conservation, Ecology and Behavior of Athene noctua. Cambridge, New York: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

At hatching Athene noctua has pink skin, cere, and toes and a light white or gray bill and claws. The first down is called neoptile and is short and white. After one week the second down, the mesoptile, begins to grow and young little owls appear a mottled gray color. The mesoptile resembles feathers but is shorter and softer. On the tenth day, the eyes open and the iris is a light yellow color. For three or four weeks the neoptile is still attached to the mesoptile. Overall the young little owls are grayer and show less contrast in their coloring than adults. Even first year adults have differences in feather shape and texture than older adults.

Little owl adults are mostly a dark brown color with cream markings over the entire body. The cream markings include streaks on the forehead and crown, rings around the eyes, a cream chin, spots and streaks on the breast and abdomen, round spots on the back and tail, and a distinct V-shape mark on the back of the head. The males and females share a similar appearance with males tending to have a lighter face. The bill and iris of A. noctua are bright yellow and the eyelids are dark. The cere, a part of the bill, is grayish to black in color. The legs are gray with a possible yellow tint. The toes are a darker gray to brown or black color and the claws are dark brown to black. Some coloring anomalies have been reported including partial albinism, leucistic coloration, or a russet color.

The wing length of A. noctua has a reported maximum of 174 mm and minimum of 158 mm but normally ranges between 151 mm and 178 mm. The wingspan of male little owls is 557.67 mm (plus or minus 11.90 mm) and for females the wingspan was recorded as 565.64 mm (plus or minus 13.15 mm). Females are generally larger than males and on average have a wing length that is 3 to 5 mm longer than males. Also, one year old little owls have a wing length that is, on average, 3 mm shorter than older adults. The subspecies of A. noctua do differ in sizes with the largest little owls from Tibet and Kashmir mountains and the smallest little owls from northeast Africa.

As the common name suggests, little owls are small with an average weight of 164 g. Male little owls are 9 to 10% lighter than females. The minimum recorded weight of an A. noctua is 98 g, the wild maximum is 270 to 280 g, and the maximum recorded in captivity is 300 to 350 g.

Range mass: 98 to 350 g.

Average mass: 164.0 g.

Average wingspan: 557.67 (males) and 565.64 (females) mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

  • MØLLER, A. 2006. Sociality, age at first reproduction and senscence: comparative analyses of birds. Jornal of Evolutionary Biology, 19: 682-689.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Athene noctua inhabits a range that encompasses a wide variety of landscapes. This species is adapted to mostly dry climates as rain decreases hunting success. Habitable landscapes also vary in altitude as Athene noctua has been observed at elevations ranging from sea-level to 2600 m. Athene noctua is a cavity nesting species and may reside in tree and rock cavities, crevices in cliffs and man-made structures, and even the nests, holes, and burrows of other animals. It prefers habitats with open hunting grounds, many small prey, areas to perch, cavities for nesting, and a stable climate. These habitat preferences of Athene noctua can be met by many landscapes and thus this species is found in a wide variety of habitats, both natural and man-made. It resides in many natural, temperate regions including: open fields, grasslands, open woodlands, steppes, semi-deserts, deserts, cliffs, non-wooded mountains, and ravines, gorges, and gullies. Athene noctua also strongly associates with anthropogenic habitats including agricultural landscapes (farmlands, meadows, pastures, orchards) and urban and suburban habitats (villages and urban buildings).

Range elevation: Sea-level (0) to 2600 m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: desert or dune ; savanna or grassland ; chaparral ; mountains

Other Habitat Features: urban ; suburban ; agricultural

  • Grzywaczewski, G. 2009. Home range size and habitat use of the little owl Athene noctua in east Poland. Ardea, 97/4: 541-545.
  • Hardouin, L., D. Robert, V. Bretagnolle. 2008. A dusk chorus effect in a nocturnal bird: support for mate and rival assessment functions. Behavioral Ecology and Sociobiology, 62: 1909-1918.
  • Le Gouar, P., H. Schekkerman, H. van der Jeugd, A. Boele, R. van Harxen, P. Fuchs, P. Stroeken, A. van Noordwijk. 2010. Long-term trends in survival of a declining population: the case of the little owl (Athene noctua) in the Netherlands. Oecologia, 166(2): 369-379.
  • Thorup, K., P. Sunde, L. Jacobsen, C. Rahbek. 2010. Breeding season food limitation drives population decline of the little owl Athene noctua in Denmark. Ibis: The International Journal of Avian Science, 152(4): 803-814.
  • Tomé, R., P. Catry, C. Bloise, E. Korpimäki. 2008. Breeding density and success, and diet composition of little owls Athene noctua in steppe-like habitats in Portugal. Ornis Fennica, 85: 22-32.
  • Żmihorski, M., J. Romanowski, G. Osojca. 2009. Habitat preferences of a declining population of the little owl, Athene noctua in Central Poland. Folia Zoologica, 58: 207-215.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Little owls hunt in various ways, even mixing the styles of hunting to suit their prey. They can be found perching and watching the ground or the air. To catch prey items on the ground, A. noctua will run and hop along the ground. They can also catch prey on the ground while flying low. Athene noctua can catch prey out of the air while flying as well. Athene noctua carries its prey with either its beak or claws. Males and females hunt and carry prey similarly, but females seem to prefer to carry prey by the neck, whereas males carry prey more often by the head. Little owls are known to catch prey as heavy as themselves. Little owls also create holes to hold surplus food. Hunting occurs mostly at night or dusk, but they have been seen hunting in daytime. Athene noctua is an opportunistic carnivore that is known to feed on a wide variety of prey including mammals, birds, reptiles, amphibians, fish, insects, molluscs, crustaceans, and other invertebrate species. The diet mainly consists of small rodents and large invertebrates (earthworms and insects). In the palearctic region, A. noctua is recorded to prey on 544 different species. The portions of the prey that little owls cannot digest are compacted internally and regurgitated as a pellet.

Animal Foods: birds; mammals; amphibians; reptiles; fish; insects; terrestrial non-insect arthropods; mollusks; terrestrial worms; aquatic crustaceans

Foraging Behavior: stores or caches food

Primary Diet: carnivore (Eats terrestrial vertebrates)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

In Great Britain and/or Ireland:
Animal / predator
adult of Athene noctua is predator of adult of Timarcha tenebricosa

Animal / associate
larva of Fannia clara is associated with nest of Athene noctua

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecosystem Roles

Little owls feed mainly on insects and small mammals and can keep these populations under control. Also, A. noctua serves as the prey for other species. Although A. noctua interacts with many species, there are no mutualistic relationships documented. Two commensal species of little owls are Trichophagata petzella and Monopis laevigell. There are at least 67 parasite species of little owls. The main types of parasites are from the groups Protozoa, Sporozoa, Metazoa, Nemathelminthes, Arachnida, and Insecta. The blood parasite Leucocytozoon ziemanni and the ectoparasite dipteran Carnus hemapterus have been reported to use little owls as hosts. It could be stated that A. noctua is a commensal species of humans. The little owls use agricultural landscapes and urban and suburban areas as habitats. Also, little owls have been seen following farming equipment that stirs up insects and taking "smoke" baths in the rising smoke of chimneys.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Little owls have many anti-predator adaptations. Athene noctua is known to call in response to predators as an alarm and defense. When other little owls hear the defense call they will hide. When A. noctua sleeps, the white markings are hidden which allows the owl to camouflage. Also, the V-shaped marking on the back of the head mimics eyes to prevent predation from behind. Further, it has been noted that in the presence of barn owls (Tyto alba), little owls will hide or become silent until the threat is perceived to be gone. Although not a normal predator of A. noctua, sometimes intraguild predation occurs between little owls and Tyto alba. The predators of little owls are larger birds including tawny owls, eagle owls, long-eared owls, peregrine falcons, common buzzards, goshawks, sparrowhawks, red kites, tawny eagles, rough-legged buzzards, booted eagles, lanners, marsh harriers, black kites, imperial eagles, and long-legged buzzards. Other predators include pine martens, feral cats, fox, domestic dogs, and corvids. The main predators of the nests are mammals, including stone martens and common genets. The eggs and chicks of little owls are predated upon by stoats, hedgehogs, brown rats, corvids, and magpies.

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Athene noctua is a very vocal bird with a repertoire of between 22 and 40 different calls. These calls are are used to contact or attract mates, defend territories against enemies and other little owls, alarm, and communicate. The vocalizations occur on average 1.87 times per hour and there is an average of 415 total seconds of calling in an hour. The vocal activity varies with time of year and day. There is usually a peak in calling before and during courtship and is lowest in the winter and summer. Also, there is an increase in call duration at dusk, called a dusk chorus phenomenon and a less pronounced increase at dawn with a lull through the night. There are more song vocalizations than calls at night. Also, little owls have been known to vocalize during daylight. The female call is generally shorter and higher pitched than the male call. The male calls are also louder and clearer than the female calls. When a predator is detected, A. noctua quiets and waits until the threat is presumably gone before resuming vocal activity. It has also been demonstrated that little owls learn to recognize the calls of neighboring little owls versus unknown little owls to reduce energy expenditure during territory defense.

Sight and hearing also allow little owls to perceive their environment. Little owls have retinal cells more similar to diurnal birds and have the poorest visual acuity compared to other birds of prey. Athene noctua can see yellow, green, blue, and (to a lesser extent) red. Little owls can also distinguish between different shades of gray, increasing the ability to see at night. Little owls can also hear sound frequencies of 3 to 4 kilocycles per second (kc/s). This ability to hear allows A. noctua to locate rodents extremely accurately.  Little owl pairs often preen and scratch each other and sleep in contact with each other. These tactile cues are used to increase pair bonding between mates. Mutual preening has also been seen amongst fledgling siblings.

Communication Channels: tactile ; acoustic

Other Communication Modes: choruses

  • Zuberogoitia, I., J. Martínez, J. Zabala, J. Martínez, A. Azkona, I. Castillo, S. Hidalgo. 2008. Social interactions between two owl species sometimes associated with intraguild predation. Ardea, 96: 109-113.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The longest lifespan of A. noctua in the wild is 15 years and 7 months old, however the median lifespan of A. noctua is 4 years. The mortality rate of adult little owls is between 24.2% and 39% per year. The mortality rate of juveniles is much higher, reported to be between 69% and 94%. The lifespan of little owls is limited mostly by prey and nest availability, but predation, parasites, weather, and human influences (habitat destruction, traffic, chemicals, electrocution, etc.) also effect longevity. Information on A. noctua lifespan is not well documented in both the wild and captivity.

Range lifespan

Status: wild:
15.583 (high) years.

Typical lifespan

Status: wild:
4 (low) years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

The courtship period of A. noctua begins with the male defending his territory. He patrols the borders of his territory and calls. The call serves as both a territorial defense to fend off other males and to attract a mate. Once a potential mate makes contact, pair bonding begins. This includes the little owls flying in pairs and sitting in the same tree. The female begins to make a "begging" call to her partner and this prompts the male to feed her prey he has captured. This feeding habit is important because it indicates that there is enough food to reproduce and feed young and also to supply the female with more food so she can gain weight for egg formation and incubation. The vocalization between partners increases as pair bonding strengthens and the couple begins nest visiting and/or copulation. The male selects potential nests within his territory and, around the time of copulation, he shows the female the nest sites until she selects one. Upon successful copulation, the female will remain in the nest and continue to "beg" her mate for food at an increasing rate. After the young have fledged the bond between the pair decreases and aggression increases. Often the partners are willing to separate at this point but not all do. The little owls show a high rate of mate fidelity. The partners will often fly together and hunt near each other. They also share body contact while sleeping and preen and scratch each other. Scratching and copulation outside of the breeding season has been reported and is believed to reduce aggression between mates when not reproducing. Although A. noctua is monogamous, when little owl densities are high and prey is plentiful, sometimes extra-pair copulations occur.

Mating System: monogamous

Athene noctua is iteroparous (produces a clutch every year). The mating season of A. noctua begins in early February and ends as late as May depending on the region. The time of egg-laying also varies with the location but can begin as early as March and end as late as August when taking into account replacement clutches. The clutch size is normally between 1 and 7, averaging 3.3, but as many as 12 has been recorded. If the first clutch is lost for some reason, a pair can lay a replacement clutch, usually of a smaller size. As soon as the eggs are laid, the incubation period begins. The incubation period is from 18 to 35 days, usually reported as 28 days. Overall hatching occurs approximately one month after laying and owlets are dependent upon the parents for two months. The average weight of newly hatched owlets is 10 to 12 g. The female remains with the nestlings for 16 days. The owlets begin to catch their own prey at 28 days and kill prey at 34 days. The offspring become fledglings as early as 28 days and as late as 35 days. The owlets become juveniles and no longer need parental care between August and the beginning of November. The juveniles settle an average of 2700 m away from their first nest. The little owls reach reproductive age at 1 year.

Hatching success of little owls is as low as 49.3%. Fledging success has been reported as low as 46.6%. These losses can be due to infertility, adults losing or abandoning the nest, predation, low prey availability, and other nest complications. The most important trait linked to the production of young is food availability. The success of young is effected by the distance of the nest to the hunting grounds and by weather during the preceding winter, the breeding season, and after hatching. Supplementing nests with food has been shown to greatly increase the production of young. The number of young fledged per breeding pair ranges from 0.6 to 2.8 fledglings per pair.

Breeding interval: Athene noctua breeds once per year

Breeding season: The breeding season of little owls begins at the earliest in February and continues until May at the latest

Range eggs per season: 1 to 12.

Average eggs per season: 3.3.

Range time to hatching: 18 to 35 days.

Average time to hatching: 28 days.

Average birth mass: 10 to 12 g.

Range fledging age: 28 to 35 days.

Average time to independence: 12 to 16 weeks.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Before copulation occurs, little owls must strengthen pair bonding. Part of this pair bonding includes the male defending his territory and providing food to the female. The female must develop fat reserves to help her produce eggs before the nest site is selected. Before the female lays eggs, she remains in the nest and the male brings prey to her. As soon as the eggs have been laid, the female begins incubating the eggs to keep them warm. Pre-hatching parental investment also includes the male bringing the female food as she incubates the eggs. The eggs hatch after about 28 days and the pre-fledging parental care begins. The male still catches prey and brings it back to the nest for the nestlings and female. The female defends, warms, and feeds her young. After 16 days the female also leaves the nest and begins bringing prey back for the nestlings. The offspring become fledglings as early as 28 days and as late as 35 days. Pre-independence parental care includes the parents still feeding and protecting the owlets one month after they reach fledgling age. Parental care ceases at the beginning of September to the beginning of November. In general, there is a two month post-hatching dependency period in which the parents are very active and energetically stressed. As the brood ages, the activity rates of the parents increase. The males are more active than the females during this period and are the main food provider, possibly linked to their lighter weight allowing them to move further and faster. Also the heavier weight of the females may help them care for and defend the nest. Although the roles of the A. noctua parents are different, both provide provisioning and protection throughout the development of the young.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Grzywaczewski, G. 2009. Home range size and habitat use of the little owl Athene noctua in east Poland. Ardea, 97/4: 541-545.
  • Hardouin, L., D. Robert, V. Bretagnolle. 2008. A dusk chorus effect in a nocturnal bird: support for mate and rival assessment functions. Behavioral Ecology and Sociobiology, 62: 1909-1918.
  • Holsegård-Rasmussen, M., P. Sunde, K. Thorup, L. Jacobsen, N. Ottesen, S. Svenne, C. Rahbek. 2009. Variation in working effort in Danish little owls Athene noctua. Ardea, 97: 547-554.
  • Johnson, D., D. Van Nieuwenhuyse, J. Génot. 2009. Survey protocol for the little owl Athene noctua. Ardea, 97/4: 403-412.
  • Le Gouar, P., H. Schekkerman, H. van der Jeugd, A. Boele, R. van Harxen, P. Fuchs, P. Stroeken, A. van Noordwijk. 2010. Long-term trends in survival of a declining population: the case of the little owl (Athene noctua) in the Netherlands. Oecologia, 166(2): 369-379.
  • MØLLER, A. 2006. Sociality, age at first reproduction and senscence: comparative analyses of birds. Jornal of Evolutionary Biology, 19: 682-689.
  • Thorup, K., P. Sunde, L. Jacobsen, C. Rahbek. 2010. Breeding season food limitation drives population decline of the little owl Athene noctua in Denmark. Ibis: The International Journal of Avian Science, 152(4): 803-814.
  • Tomé, R., P. Catry, C. Bloise, E. Korpimäki. 2008. Breeding density and success, and diet composition of little owls Athene noctua in steppe-like habitats in Portugal. Ornis Fennica, 85: 22-32.
  • Van Nieuwenhuyse, D., J. Genot, D. Johnson. 2008. The Little Owl: Conservation, Ecology and Behavior of Athene noctua. Cambridge, New York: Cambridge University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Athene noctua

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATCTTCGGCGCATGAGCAGGTATAGTTGGAACTGCCCTAAGCTTGCTCATCCGAGCCGAACTTGGACAACCCGGAACCCTTCTAGGAGACGATCAAATCTACAACGTAGTCGTCACTGCCCACGCCTTCGTCATAATCTTCTTTATAGTCATACCAATCATGATTGGCGGCTTTGGAAACTGGTTAGTCCCCCTAATAATCGGAGCCCCAGACATGGCCTTCCCACGTATAAACAACATAAGCTTCTGACTGCTACCCCCCTCCTTCATACTCCTCCTAGCATCCTCCACAGTAGAGGCTGGTGTTGGTACGGGATGAACAGTCTACCCACCACTGGCTAGCAACCTAGCCCACGCCGGAGCCTCGGTAGACCTAGCCATCTTCTCCTTACACTTAGCCGGGGTATCCTCCATCCTAGGAGCAATTAACTTTATTACAACCGCCATCAACATAAAACCACCATCCCTCTCACAACACCAAACCCCCCTATTTGTGTGATCAGTGCTTATCACTGCTATCCTCCTACTATTATCTCTCCCAGTCCTAGCAGCAGGTATTACTATACTGTTAACAGACCGCAACCTGAACACCACATTCTTTGACCCAGCCGGCGGAGGGGACCCAATCCTGTACCAACACTTATTTTGATTCTTCGGCCACCCAGAAGTTTACATCCTTATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Athene noctua

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Athene noctua is listed by the International Union for Conservation of Nature and Natural Resources (IUCN) Red List as least concern. However, there is a documented decline seen throughout Europe of not only little owls, but also other owls. It is important to research little owls to gather information about the general decline of owls. The main contributors to population decline are prey and nest availability and human habitat destruction. The development of nest boxes appropriate for little owls has boosted numbers, while current conservation efforts focus on increasing food availability during the breeding season and gathering more information about the causes of decline.

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Resident breeder.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 560000-1300000 breeding pairs, equating to 1680000-3900000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 5000000-15000000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Athene noctua can be found nesting in and on the faces of buildings. This is considered unattractive and measures have been taken in some places to avoid this (including nets hung over signs). Other than this superficial damage, Athene noctua has no known adverse affects on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Little owls eat many insects and small mammals, controlling populations that are pests to humans. There has been a dramatic decline in some owl populations throughout Europe, including A. noctua. Athene noctua is perfect for studying owl declines in rural habitats because the species is well known to the public, present in significant numbers, easy to research, and quickly reacts to conservation actions. The presence of A. noctua attracts predators that were once desirable to humans. Due to this, little owls used to be traded and carried on staffs to attract and catch their predators. Little owls were also once traded as pets.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Owl

The Little Owl (Athene noctua) is a bird which is resident in much of the temperate and warmer parts of Europe, Asia east to Korea, and north Africa. It is not native to Great Britain, but was first introduced in 1842,[2] by Thomas Powys and is now naturalised there. It was also successfully introduced to the South Island of New Zealand in the early 20th century.

This species is a part of the larger grouping of owls known as typical owls, Strigidae, which contains most species of owl. The other grouping is the barn owls, Tytonidae.

Contents

Description

The Little Owl is a small owl, 23-27.5 cm (9 to 11 inches) in length. The adult Little Owl of the most widespread form, the nominate A. n. noctua, is white-speckled brown above, and brown-streaked white below. It has a large head, long legs, and yellow eyes, and its white “eyebrows” give it a stern expression. This species has a bounding flight like a woodpecker. Juveniles are duller, and lack the adult's white crown spots. The call is a querulous kee-ik.

There is a pale grey-brown Middle Eastern type known as Syrian Little Owl A. n. lilith. Other forms include another pale race, the north African A. n. desertae, and three intermediate subspecies, A. n. indigena of southeast Europe and Asia Minor, A. n. glaux in north Africa and southwest Asia, and A. n. bactriana of central Asia. A recent paper in the ornithological journal Dutch Birding (vol. 31: 35-37, 2009) has advocated splitting the southeastern races as a separate species Lilith's Owl Athene glaux (with subspecies A. g. glaux, A. g. indigena, and A. g. lilith).

Distribution and status

There are 13 recognized races of Little owl spread across Europe and Asia. The Little Owl was sacred to the goddess Athena, from whom it gets the generic name. This is one of the most distributed owls and, due to its adaptability to human settlements and small size, probably ranks among the world's most numerous owl species.

Behaviour and ecology

Juvenile

This is a sedentary species which is found in open country such as mixed farmland and parkland. It takes prey such as insects, earthworms, amphibians, but also small birds and mammals. It can attack birds of considerable size like game birds. It is partly diurnal and often perches boldly and prominently during the day.[3]

Little Owl egg (middle) compared with eggs of a Goldcrest (right) and chicken (left)

It becomes more vocal in nights as the breeding season approaches. Nest location varies based on the habitat, nests being found in holes in trees, rocks, cliffs, river banks, walls, buildings etc.[3] It lays 3-5 eggs which are incubated by the female for 28–29 days, with a further 26 days to fledging. Little Owls will also nest in buildings, both abandoned and those fitted with custom owl nest boxes. If living in an area with a large amount of human activity, Little Owls may grow used to man and will remain on their perch, often in full view, while humans are around.

References

  1. ^ BirdLife International (2012). "Athene noctua". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106002287. Retrieved 16 July 2012.
  2. ^ Greenoak, Francesca (1997-10-31). British Birds: Their Names, Folklore and Literature. Christopher Helm Publishers Ltd. ISBN 0-7136-4814-7. 
  3. ^ a b Baker, ECS (1927). Fauna of British India. Birds 4 (2 ed.). Taylor and Francis, London. pp. 441–443. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!