Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Brief Summary

Biology

Tawny owls feed mainly on small mammals such as voles, as well as insects. They occupy a favourite perch, dropping onto prey that passes by; inedible remains such as fur and bones in the form of 'owl pellets' gather below these perches (3). Pairs begin to form territories in the autumn; this involves much hooting and calling, and males occasionally clap their wings together in a form of display (3). Nesting usually takes place in holes in hollow trees, although abandoned crow nests may be used (3). In March or early April, between 2 and 4 white eggs are laid. These are incubated by the female for up to 30 days. The male takes charge of feeding the young, who fledge after 32-37 days (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

The tawny owl is the most common and widespread British owl (3). It is most often heard than seen; it produces a variety of vocalisations, including the familiar 'ke-wick' contact calls (4). It has a compact body and a large rounded head, and varies in colour from greyish to reddish brown with black and white streaks (2). The sexes are similar in appearance (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comprehensive Description

Longueur : 40-42 cm (mâles plus petits que les femelles), envergure moyenne : 93 cm (mâles) à 98 cm (femelles), poids : 330 à 475 g pour les mâles et 400 à 630 g pour les femelles.

La Chouette hulotte se caractérise par une grosse tête ronde et un corps assez trapu. Elle possède un grand disque facial qui entoure de gros yeux brun foncés. L’espèce témoigne de deux morphotypes indépendants du sexe et de l’âge : une forme rousse et une forme grise. En vol, sa silhouette est plus ramassée et moins fine celle du Hibou-moyen duc et ses larges ailes sont fortement barrées en dessous.

La Chouette hulotte possède des mœurs nocturnes. Son activité est néanmoins maximale au crépuscule (20 min après coucher du soleil) et avant l’aube (40 min avant le lever du soleil) avec un moment de repos entre les deux aux alentours de minuit. L’activité est fortement réduite par mauvais temps et à l’inverse, elle est accentuée en période d’élevage des jeunes. La journée, la Chouette hulotte est discrète, au fond de sa cavité, collé à un tronc ou remisée dans un arbre à lierre.

La Chouette hulotte chasse à l’affut, perchée sur une branche ou un piquet, dans une zone dégagée de son territoire (clairière, coupe forestière, chemin). Si aucune proie ne se présente, elle teste un autre perchoir.
Elle s’alimente surtout de petits rongeurs, notamment de campagnols (avec prédominance du Campagnol roussâtre) et de mulots. Elle peut cependant adapter son régime alimentaire en fonction de la disponibilité en proies, du milieu occupé ou de la rigueur des hivers. Elle peut ainsi capturer d’autres mammifères (chauves-souris, taupes, hérissons), des oiseaux (merles, moineaux, mais aussi geais, pigeons, ...), amphibiens ou invertébrés (insectes, limaces, ...). Ses pelotes de rejection mesurent en moyenne 48 mm de long et 24 mm de diamètre.

La Chouette hulotte est très sédentaire. Elle ne migre pas et elle est très fidèle à son site de nidification. Les couples sont aussi très fidèles ; dans la plupart des cas ils resteront unis toute leur vie. La Chouette hulotte est une espèce très territoriale.

La femelle pond de 1 à 6 œufs, vers le mois de janvier-février et les couve ensuite pendant 28 à 30 jours. Une fois sortis de l’œuf, les poussins restent au nid pendant à nouveau 28 jours environ. Puis les jeunes quittent le nid, alors même qu’ils ne savent pas encore voler. Pendant 2 à 3 semaines, ils resteront donc à proximité du nid parental, au sol ou à mi-hauteur dans la végétation, avant de prendre leur premier envol. Pendant toute cette phase d’émancipation, les parents continuent de les nourrir. Les jeunes dispersent ensuite sur de courtes distances (rarement à plus de 50 km et même plutôt de l’ordre de quelques kilomètres).

La Chouette hulotte est une espèce forestière et elle niche dans les cavités amples des arbres. Son domaine vital est estimé à environ 100 ha mais il fluctue selon l’essence dominante du boisement, allant de 50 ha (vieilles futaies de feuillus riches en proies) à 250 ha (boisements de résineux). Elle peut ainsi occuper les grands massifs comme les bois plus petits et même les bocages. Ses capacités d’adaptation, notamment alimentaires, lui permettent de fréquenter aussi les espaces boisés en contexte urbain.

Manifestation vocale : Voix retentissante et mélodieuse à grinçante et inquiétante. Chant territorial du mâle composé de trois strophes débitées sur un rythme très caractéristique : houuuuuuuuu ou ouhouhouhouhou. Cri de localisation ou de quémandage de la femelle : kviit dont la tonalité peut être douce, enrouée, grinçante, rauque ou claquante.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Strix aluco can be found across the Palearctic Region from the Iberian Peninsula to as far east as China and Korea and south to Iran and the Himalayan mountain range. It is native to the British Isles and is commonly found there, except for in northern Scotland. Tawny owls are not found in Ireland. Though they are nonmigratory, they have been found wintering in Morocco and, rarely, in Egypt and the Balearic and Canary Islands.

There are 11 known subspecies of tawny owls: Strix aluco aluco in northern and central Europe from Scandinavia to the Mediterranean and Black Sea, Strix aluco mauritanica, from northwestern Africa from Morocco to Tunisia and Mauritania, Strix aluco sylvatica, in western Europe including Britain, Strix aluco siberiae in Central Russia from the Urals to western Siberia, Strix aluco sanctinicola in western Iran and northeast Iraq, Strix aluco wilkonskii from Palestine to Northern Iran and the Caucasus, Strix aluco harmsi, in Turkmenistan, Strix aluco bidulphi, in northwestern India and Pakistan, Strix aluco nivicola, from Nepal to southeastern China and south to northern Myanmar and Thailand, Strix aluco yamadae, in Taiwan, Strix aluco ma, in northeastern China and Korea.

Biogeographic Regions: palearctic (Native )

  • World Owl Trust. 2005. "Tawny Owl Strix aluco" (On-line). World Owl Trust. Accessed March 18, 2010 at http://www.owls.org/Species/strix/tawny_owl.htm.
  • Lack, P. 1986. The Atlas of Wintering Birds in Britain and Ireland. Calton: T. & A. D. Poyser Ltd..
  • Ramsay, R. 1923. Guide to the Birds of Europe and North Africa. London: Gurney and Jackson.
  • Snow, D., C. Perrins. 1998. The Birds of the Western Palearctic. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Widespread and numerous throughout Britain, but becomes scarce in north Scotland (5). It occurs across the Palaearctic from Spain to China, reaching as far south as North Africa (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Tawny owls are medium-sized and compact. They have large, rounded heads with no ear tufts. These owls exhibit geographic variation in color. They can be rufous-brown; greyish-brown with the mottled plumage, finely streaked, and with dark vermiculation (more commonly seen in the eastern part of the bird's range); or lighter grey and white (in the northernmost parts of their distribution). South and east Asian subspecies have barred undersides instead of striped and have fine facial disk lines. Siberian and Scandinavian subspecies are 12% larger and 40% heavier than western European tawny owls, with 13% longer wings. Females are more than 25% heavier and 5% longer than males.

In all subspecies the facial discs are usually plain, with pale whitish crown-stripes or extra "eyebrows" that add to the owl's kindly expression. The eyes are black, which prevents them from being confused with the yellow eyes of long-eared owls, which can appear black in headlights at night due to their large pupils. The shoulder feathers are lined with white spots and there are no pale markings on the inner primary feathers. The tail is finely barred. Young owls are more pale than adults. When flying these owls have quick wingbeats and glide long and straight on broad wings. Great grey owls, eagle owls and Ural owls resemble tawny owls in shape, but are much larger.

Average mass: 420 (male), 520 (female) g.

Average length: 38 cm.

Average wingspan: 99 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tawny owls live in open, deciduous, or mixed forest or woodland, agricultural areas with trees, parks, cemeteries, and large gardens, preferring locations with access to water. While sometimes found in mature conifer forests as well, they prefer mature broadleaf trees, such as ancient oaks with large holes for nesting. Tawny owls are frequently found near human habitation (for example, in central London) and in the winter can be found nesting in abandoned buildings and rock cavities. They are lowland birds in the colder parts of their range, but can breed at higher altitudes.

Range elevation: 2800 (high) m.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest

Other Habitat Features: urban ; suburban ; agricultural

  • Arlott, N. 2009. Birds of Europe, Russia, China, and Japan : Non-passerines, Loons to Woodpeckers.. Princeton, N.J.: Princeton University Press.
  • Svensson, L., D. Zetterström. 1999. Birds of Europe. Princeton, N.J.: Princeton University Press.
  • Voous, K. 1988. Owls of the Northern Hemisphere. London: Collins.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Typically occurs in broad-leaved or mixed woodland, but will also inhabit trees in hedgerows, parkland, churchyards, farmland, and coniferous forests (3). In winter it may take shelter in disused buildings and rock cavities (5).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Tawny owls prey on a variety of animals, ranging from mostly woodland rodents to other small mammals, amphibians, birds, beetles, and worms. Birds represent a larger percentage of their diet in urban areas, including mallards and kittiwakes.

Tawny owls hunt primarily between dusk and dawn. They perch and watch for prey, then use silent gliding flight to catch their victim on the ground, extending the wings to cover the prey and killing it with feet and claws. Occasionally they may use the beak to deliver a blow to the base of the victim's neck. Tawny owls have also been reported to beat their wings to flush smaller birds out of hiding and into flight and then take aerial pursuit. They also fly over grassland, marshland, or bushes looking for bats or incubating birds to pluck from their roosting perches and nests. Mother owls may hunt during the day to feed their young.

Owls swallow prey whole, parts that are indigestible are later regurgitated in the form of pellets. These medium-sized pellets, usually grey in color, contain mostly rodent fur and bones and are found around trees where owls nest. Owl pellets can reveal much about the dietary habits of the bird in question.

Animal Foods: birds; mammals; amphibians; fish; insects; terrestrial worms

Primary Diet: carnivore (Eats terrestrial vertebrates)

  • Brown, R., J. Ferguson, M. Lawrence, D. Lees. 1987. Tracks and Signs of the Birds of Britain and Europe (Helm Identification Guides). London: Christopher Helm Publishers Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Animal / parasite / endoparasite
Centrorhynchus aluconis endoparasitises Strix aluco

Animal / dung/debris feeder
clustered apothecium of Cheilymenia cadaverina feeds on dung/debris pellet of Strix aluco

Animal / predator
Strix aluco is predator of Sorex

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Tawny owls are formidable predators in all of the habitats they occupy. Smaller owls cannot coexist with tawny owls, which will prey on them as well as compete for prey. Tawny owls also displace barn owls in urban areas, taking over their nests in buildings. As predators, tawny owls help control populations of natural prey.

Tawny owls are hosts to several kind of blood parasites, including Leucocytozoon, Haemoproteus, and Trypanosoma. These parasites negatively affect the fitness of the afflicted bird and breeding behaviors within the morphs. The rufous morph is more susceptible to these parasites because of their open habitat and greater exposure.

Commensal/Parasitic Species:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Tawny owls are preyed on by larger birds such as northern goshawks, common buzzards, and other species of owls, such as Ural and eagle owls. Pine martens are known to raid owl nests, and human supplying of artificial nesting boxes in urban areas makes owl fledglings easier for predators to find. Eurasian jackdaws sometimes build nests on top of female tawny owls and their nests, killing both adult and chicks.

A 2005 study revealed red foxes, stone martens, and other mammalian predators as a prime factor in the mortality rates of fledgling tawny owls, 36% of fledglings die within the first 55 days of leaving the nest. Predation increases by over 44% as the year progresses, providing selection pressure for early breeding in Strix aluco. Avian predators such as raptors pose the second biggest threat to juveniles.

Known Predators:

Anti-predator Adaptations: cryptic

  • Sunde, P. 2005. Predators control post-fledging mortality in tawny owls, Strix aluco. Oikos, 110: 461-472.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Strix aluco preys on:
Tyto alba
Dryomys nitedula
Clethrionomys glareolus
Sorex araneus
Plecotus auritus

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Tawny owls are notably vocal. The most commonly known call is "ke-WICK" repeated shrilly, with frightening variations used as alarm or to display aggression. The song is mournful and ocarina-like, and is easily mimiced by blowing into one's hands. It begins with a long drawn-out note falling in pitch, followed by a short pause and a series of quick, shivering notes, to end with another falling note: "HOOOOuh.......ho, ho'ho'ho'HOOOOOOuh." The female exhibits a hoarse and wailing version of this song. The call used in mating is called the 'xylophone trill': "'o'o'o'o'o'o'o'o'" and it used by both sexes. Young owls beg for food by squeaking: "PSEE-ep."

Tawny owl eyes are at the front of the head, with a field overlap of 50 to 70%. This overlap enables greater binocular vision than birds that hunt during the day. The increased visual acuity of the owl, while not much greater than that in humans, is due to optical factors such as the shape and size of the eye itself rather than retinal sensitivity.

Their two ear openings have different structures and are located asymmetrically on the head for directional hearing. Hearing is a crucial sense for a nocturnal hunter. These owls can use the minute differences in the time of arrival of sound at each ear to locate the source. The left ear tilts downward to catch sounds coming from below. The ears are underneath the facial disk feathers, which are transparent to sound and supported by the movable pre-aural flap. The hearing of Strix aluco is ten times better than that of humans, although this acute hearing can be easily interfered with by the sound of rainfall. Prolonged rain can bring about an inability to hunt and inevitable starvation.

Communication Channels: acoustic

  • Burton, R. 1985. Bird Behaviour. London: Granada Publishing.
  • Martin, G. 1977. Absolute visual threshold and scotopic spectral sensitivity in the tawny owl Strix aluco. Nature, 268: 636-638.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The typical lifespan of Strix aluco in the wild is 4 years. The oldest wild tawny owl ever recorded lived 21 years and 5 months. Captive birds can live over 27 years. The adult annual survival rate is 73.8% and the juvenile annual survival rate is 30.1%. If juveniles fail to find a vacant territory after leaving the nest they usually starve to death.

In an experiment conducted in 2008 to establish the post-release survival rates of hand-reared tawny owls, researchers discovered that 66% survived longer than six weeks. Only 39% survived over a year and only one bird survived longer than the average lifespan of wild tawny owls. This has been deemed a sufficient percentage to justify the rehabilitation of juvenile owls to be released in the wild by the Royal Society for the Prevention of Cruelty to Animals.

Range lifespan

Status: wild:
21.4 (high) years.

Range lifespan

Status: captivity:
27 (high) years.

Average lifespan

Status: wild:
4 years.

  • Leighton, K., D. Chilvers, A. Charles, A. Kelly. 2008. Post-release survival of hand-reared tawny owls (Strix aluco) based on radio-tracking and leg-band return data. Animal Welfare, 17: 207-214.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 21.5 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Tawny owls reach sexual maturity after one year and most form monogamous pairs for life, although some males exhibit polygynous behavior, mating with more than one female. In October or November, male owls establish territories while females find nesting holes. At this point in the year, males and females roost separately. The pair defend their territory year-round with minor changes to boundaries each year. As winter approaches, territories are finalized and pre-breeding behavior begins with males and females roosting together. This is the time for courtship feeding, which is centered around the future nesting site. A male perches near a female, swaying from side to side and up and down. He raises each wing alternatively, then together, and puffs out his feathers to appear larger. He slides closer to her on the branch, grunting softly and clapping his wings. In response, the female screeches and makes a variety of noises. She may also puff her feathers out and quiver.

Some mating behavior differs between rufous and greyish-brown morphs. Greyish-brown females breed less often than rufous females and may not breed every year, although survival probability between morphs is similar. They do, however, produce offspring of higher quality and fitness than those of rufous females. It would seem that color polymorphism is an indicator of individual quality, with grey morphs having a fitness advantage.

Mating System: monogamous ; polygynous

The breeding season is from January to July. The nesting site is usually a hole in a tree, although they will take over abandoned nests of other birds in trees and cliffs, squirrel dreys, holes in old buildings, and artificial nest boxes. In the southern ranges nesting begins in February, and in the northern ranges nesting is in mid-March. Clutches are laid mid-March to early May, usually consisting of 2 to 3 eggs. Sometimes as few as 1 egg or as many as 9 are laid. The eggs are white and are 48 x 39 mm in size, weighing 39 g, of which 7% is shell. Females incubate eggs for about 30 days until they hatch into downy, altricial chicks. Chicks fledge in another 35 to 39 days.

The success of broods depends heavily on the ages of parents. Older birds have the ability to deliver a greater mass of alternate prey at a higher frequency and productivity than younger birds when preferred prey is scarce. Young parents pay a higher reproductive cost as they have lower ability to exploit alternative food sources and provide resources to their brood due to their poorer body condition and the need to tend to their own survival.

Breeding interval: Tawny owls breed once yearly, although grey morphs may not breed every year.

Breeding season: Breeding occurs from January to July.

Range eggs per season: 1 to 9.

Average eggs per season: 2-3.

Range time to hatching: 27 to 32.5 days.

Average time to hatching: 30 days.

Range fledging age: 32 to 40.5 days.

Average fledging age: 35-39 days.

Average time to independence: 2-3 months.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Tawny owls invest heavily in their chicks. Once the eggs have hatched, males bring food to the nest. Females leaves the nest only to hunt once the downy, altricial chicks are several days old and for most of the time remains close to her brood. Even after fledging, juveniles depend on their parents for food for 2 to 3 months after leaving the nest. After this point, around August to November, young owls must leave to find their own hunting territories and fend for themselves or risk starving to death.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

  • British Trust for Ornithology (BTO). 2010. "Tawny Owl Strix aluco [Linnaeus, 1758]" (On-line). BirdFacts. Accessed March 18, 2010 at http://blx1.bto.org/birdfacts/results/bob7610.htm.
  • World Owl Trust. 2005. "Tawny Owl Strix aluco" (On-line). World Owl Trust. Accessed March 18, 2010 at http://www.owls.org/Species/strix/tawny_owl.htm.
  • Lewis, D. 2006. "OwlPages.com" (On-line). Eurasian Tawny Owl - Strix aluco. Accessed April 15, 2010 at http://www.owlpages.com/owls.php?genus=Strix&species=aluco.
  • Roulin, A., B. Dcuret, P. Ravussin, R. Altwegg. 2003. Female colour polymorphism covaries with reproductive strategies in the tawny owl Strix aluco. Journal of Avian Biology, 34: 393-401.
  • Sasvária, L., Z. Hegyib, T. Csörgõa, I. Hahnc. 2000. Age-dependent diet change, parental care and reproductive cost in tawny owls Strix aluco. Acta Oecologica, 21: 267-275.
  • Snow, D., C. Perrins. 1998. The Birds of the Western Palearctic. Oxford: Oxford University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Strix aluco

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Strix aluco

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACAAAGACATTGGCACCCTCTACCTAATCTTCGGCACATGAGCCGGCATAGTTGGCACTGCCCTTAGCCTGCTCATCCGAGCCGAACTAGGTCAACCCGGAACACTTCTAGGTGATGATCAAATCTACAATGTAATCGTTACCGCCCATGCCTTTGTAATAATTTTCTTCATAGTCATACCAATCATGATCGGAGGATTTGGAAACTGACTGGTCCCATTAATAATTGGAGCCCCAGACATGGCCTTTCCCCGCATAAACAACATAAGCTTTTGACTCCTCCCACCCTCATTCCTACTCCTATTAGCATCCTCTACAGTAGAAGCCGGGGCGGGCACCGGATGAACCGTCTACCCCCCGCTAGCCAGCAACCTGGCCCACGCTGGGGCCTCAGTAGACCTGGCCATCTTCTCCCTCCACCTAGCCGGAGTGTCCTCCATCCTGGGGGCAATCAACTTCATCACCACCGCCATTAACATAAAACCCCCCTCCCTGTCACAGTACCAAACCCCCCTATTTGTGTGATCCGTCCTTATCACGGCCATTCTCCTACTTCTATCACTCCCCGTCCTTGCTGCAGGCATCACTATGTTACTAACTGACCGTAACCTAAACACTACATTCTTCGACCCTGCCGGCGGGGGCGACCCTATCCTATACCAACACCTCTTCTGATTCTTTGGACACCCAGAAGTCTACATCCTCATCCTACCAGGATTTGGAA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Tawny owls are of least concern on the IUCN list and populations are stable. They are considered highly adaptable and are locally very common.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Common and widespread (3). Protected at all times under the Wildlife and Countryside Act, 1981 (6). Included in the Birds of Conservation Concern Green List (low conservation concern) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 480,000-1,000,000 breeding pairs, equating to 1,440,000-3,000,000 individuals (BirdLife International 2004). Europe forms 50-74% of the global range, so a very preliminary estimate of the global population size is 2,000,000-6,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

The British population of the tawny owl is not currently threatened.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Specific conservation action has not been targeted at this species.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Because of their fierce protectiveness of nests, any potential intruder may be attacked, including humans. Humans have been attacked by Strix aluco, even without apparent provocation.

Negative Impacts: injures humans

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Strix aluco has no major positive impacts on humans aside from preying upon small animals that may be considered agricultural pests.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Tawny owl

"Brown owl" redirects here. For other uses, see Brown owl (disambiguation).

The tawny owl or brown owl (Strix aluco) is a stocky, medium-sized owl commonly found in woodlands across much of Eurasia. Its underparts are pale with dark streaks, and the upperparts are either brown or grey. Several of the eleven recognised subspecies have both variants. The nest is typically in a tree hole where it can protect its eggs and young against potential predators. This owl is non-migratory and highly territorial. Many young birds starve if they cannot find a vacant territory once parental care ceases.

This nocturnal bird of prey hunts mainly rodents, usually by dropping from a perch to seize its prey, which it swallows whole; in more urban areas its diet includes a higher proportion of birds. Vision and hearing adaptations and silent flight aid its night hunting. The tawny owl is capable of catching smaller owls, but is itself vulnerable to the eagle owl or Northern goshawk.

Although many people believe this owl has exceptional night vision, its retina is no more sensitive than a human's. Rather, it is its asymmetrically placed ears that are key to its hunting because they give the tawny owl excellent directional hearing. Its nocturnal habits and eerie, easily imitated call, have led to a mythical association of the tawny owl with bad luck and death.

Description[edit]

The tawny owl is a robust bird, 37–46 cm (15–18 in) in length, with an 81–105 cm (32–41 in) wingspan. Weight can range from 385 to 800 g (0.849 to 1.764 lb).[2][3] Its large rounded head lacks ear tufts, and the facial disc surrounding the dark brown eyes is usually rather plain. The nominate race has two morphs which differ in their plumage colour, one form having rufous brown upperparts and the other greyish brown, although intermediates also occur. The underparts of both morphs are whitish and streaked with brown.[4] This species is sexually dimorphic; the female is much larger than the male, 5% longer and more than 25% heavier.[5]

The tawny owl flies with long glides on rounded wings, less undulating and with fewer wingbeats than other Eurasian owls, and typically at a greater height. The flight of the tawny owl is rather heavy and slow, particularly at takeoff.[6] As with most owls, its flight is silent because of its feathers' soft, furry upper surfaces and a fringe on the leading edge of the outer primaries.[7] Its size, squat shape and broad wings distinguish it from other owls found within its range; great grey, eagle owl and Ural owls are similar in shape, but much larger.[6]

An owl's eyes are placed at the front of the head and have a field overlap of 50–70%, giving it better binocular vision than diurnal birds of prey (overlap 30–50%).[8] The tawny owl's retina has about 56,000 light-sensitive rod cells per square millimetre (36 million per square inch); although earlier claims that it could see in the infrared part of the spectrum have been dismissed,[9] it is still often said to have eyesight 10 to 100 times better than humans in low-light conditions. However, the experimental basis for this claim is probably inaccurate by at least a factor of 10.[10] The owl's actual visual acuity is only slightly greater than that of humans, and any increased sensitivity is due to optical factors rather than to greater retinal sensitivity; both humans and owl have reached the limit of resolution for the retinas of terrestrial vertebrates.[10]

Field of view compared with a pigeon

Adaptations to night vision include the large size of the eye, its tubular shape, large numbers of closely packed retinal rods, and an absence of cone cells, since rod cells have superior light sensitivity. There are few coloured oil drops, which would reduce the light intensity.[11] Unlike diurnal birds of prey, owls normally have only one fovea, and that is poorly developed except in daytime hunters like the short-eared owl.[8]

Hearing is important for a nocturnal bird of prey, and as with other owls, the tawny owl's two ear openings differ in structure and are asymmetrically placed to improve directional hearing. A passage through the skull links the eardrums, and small differences in the time of arrival of a sound at each ear enables its source to be pinpointed. The left ear opening is higher on the head than the larger right ear and tilts downward, improving sensitivity to sounds from below.[8] Both ear openings are hidden under the facial disk feathers, which are structurally specialized to be transparent to sound, and are supported by a movable fold of skin (the pre-aural flap).[12]

An owl's retina has a single fovea.[13]

The internal structure of the ear, which has large numbers of auditory neurons, gives an improved ability to detect low-frequency sounds at a distance, which could include rustling made by prey moving in vegetation.[12] The tawny owl's hearing is ten times better than a human's,[12] and it can hunt using this sense alone in the dark of a woodland on an overcast night, but the patter of raindrops makes it difficult to detect faint sounds, and prolonged wet weather can lead to starvation if the owl cannot hunt effectively.[8]

The commonly heard contact call is a shrill, kew-wick but the male has a quavering advertising song hoo...ho, ho, hoo-hoo-hoo-hoo. William Shakespeare used this owl's song in Love's Labour's Lost (Act 5, Scene 2) as "Then nightly sings the staring owl, Tu-whit; Tu-who, a merry note, While greasy Joan doth keel the pot", but this stereotypical call is actually a duet, with the female making the kew-wick sound, and the male responding hooo.[4] The call is easily imitated by blowing into cupped hands through slightly parted thumbs, and a study in Cambridgeshire found that this mimicry produced a response from the owl within 30 minutes in 94% of trials.[14] A male’s response to a broadcast song appears to be indicative of his health and vigour; owls with higher blood parasite loads use fewer high frequencies and a more limited range of frequencies in their responses to an apparent intruder.[15]

Geographical variation[edit]

Although both colour morphs occur in much of the European range, brown birds predominate in the more humid climate of western Europe, with the grey phase becoming more common further east; in the northernmost regions, all the owls are a cold-grey colour. Siberian and Central Asian subspecies have grey and white plumage, the North African race is dark grey-brown, and South and East Asian birds have barred, not striped, underparts, and fine lines around the facial disc. The Siberian and Scandinavian subspecies are 12% larger and 40% heavier, and have 13% longer wings than western European birds,[12] in accordance with Bergmann's rule which predicts that northern forms will typically be bigger than their southern counterparts.[16]

The plumage colour is genetically controlled, and studies in Finland and Italy indicate that grey-morph tawny owls have more reproductive success, better immune resistance, and fewer parasites than brown birds. Although this might suggest that eventually the brown morph could disappear, the owls show no colour preference when choosing a mate, so the adverse selection pressure is reduced. There are also environmental factors involved. The Italian study showed that brown-morph birds were found in denser woodland, and in Finland, Gloger's rule would suggest that paler birds would in any case predominate in the colder climate.[17][18]

Taxonomy[edit]

An individual probably of the western subspecies S. a. sylvatica

The species was first described by Linnaeus in his Systema naturae in 1758 under its current scientific name.[19] The binomial derives from Greek strix "owl" and Italian allocco, "tawny owl" (from Latin ulucus "screech-owl").[5]

The tawny owl is a member of the wood-owl genus Strix, part of the typical owl family Strigidae, which contains all species of owl other than the barn owls. Within its genus, the tawny owl's closest relatives are Hume's owl, Strix butleri, (formerly considered to be conspecific), the Himalayan owl, Strix nivicolum, (sometimes considered conspecific), its larger northern neighbour, the Ural owl, S. uralensis, and the North American barred owl, S. varia.[12] The EarlyMiddle Pleistocene Strix intermedia is sometimes considered a paleosubspecies of the tawny owl, which would make it that species' immediate ancestor.[20]

The tawny owl subspecies are often poorly differentiated, and may be at a flexible stage of subspecies formation with features related to the ambient temperature, the colour tone of the local habitat, and the size of available prey. Consequently, various authors have historically described between 10 and 15 subspecies.[12] The currently recognised subspecies are listed below.[21]

SubspeciesRangeDescribed by (parentheses indicate originally in a different genus)
S. a. alucoN & C Europe from Scandinavia to the Mediterranean and Black SeaLinnaeus, 1758
S. a. sylvaticaW Europe including Great BritainShaw, 1809
S. a. biddulphiNW Pakistan and Kashmir regionScully, 1881
S. a. willkonskiiPalestine to N Iran and the Caucasus(Menzbier, 1896)
S. a. mauritanicaNW Africa from Morocco to Tunisia and Mauritania(Witherby, 1905)
S. a. sanctinicolaiW Iran, NE Iraq(Zarudny, 1905)
S. a. harmsiTurkmenistan(Zarudny, 1911)
S. a. siberiaeC Russia from Urals to W SiberiaDementiev, 1933

Distribution and habitat[edit]

Ancient deciduous woodland is a favoured habitat.

The tawny owl has a distribution stretching discontinuously across temperate Eurasia from Great Britain and the Iberian Peninsula eastwards to western Siberia, and India. The subspecies S. a. mauritanica extends the range into northwest Africa. This essentially non-migratory owl is absent from Ireland, and only a rare vagrant to the Balearic and Canary Islands.[6]

This species is found in deciduous and mixed forests, and sometimes mature conifer plantations, preferring locations with access to water. Cemeteries, gardens and parks have allowed it to spread into urban areas, including central London. The tawny owl is mainly a lowland bird in the colder parts of its range, but breeds to 550 metres (1,800 ft) in Scotland, 1,600 m (5,250 ft) in the Alps, 2,350 m (7,700 ft) in Turkey,[6] and up to 2,800 m (9,180 ft) in Burma.[12]

The tawny owl has a geographical range of at least 10 million km² (3.8 million mi²) and a large population including an estimated 970,000–2,000,000 individuals in Europe alone. Population trends have not been quantified, but there is evidence of an overall increase. This owl is not believed to meet the IUCN Red List criterion of declining more than 30% in ten years or three generations and is therefore evaluated as "least concern".[1] This species has expanded its range in Belgium, the Netherlands, Norway and Ukraine, and populations are stable or increasing in most European countries. Declines have occurred in Finland, Estonia, Italy and Albania.[6]

Behaviour[edit]

Breeding[edit]

The young leave the nest before fledging.

Tawny owls pair off from the age of one year, and stay together in a usually monogamous relationship for life. An established pair's territory is defended year-round and maintained with little, if any, boundary change from year to year. The pair sit in cover on a branch close to a tree trunk during the day, and usually roost separately from July to October.[6] Roosting owls may be discovered and "mobbed" by small birds during the day, but they normally ignore the disturbance.[12]

The tawny owl typically nests in a hole in a tree, but will also use old European Magpie nests, squirrel drey or holes in buildings, and readily takes to nest boxes. It nests from February onwards in the south of its range, but rarely before mid-March in Scandinavia.[6] The glossy white eggs are 48 x 39 mm (1.89 x 1.54 in) in size and weigh 39.0 g (1.4 oz) of which 7% is shell. The typical clutch of two or three eggs is incubated by the female alone for 30 days to hatching, and the altricial, downy chicks fledge in a further 35–39 days.[5] The young usually leave the nest up to ten days before fledging, and hide on nearby branches.[6]

This species is fearless in defence of its nest and young, and, like other Strix owls, strikes for the intruder's head with its sharp talons. Because its flight is silent, it may not be detected until it is too late to avoid the danger. Dogs, cats and humans may be assaulted, sometimes without provocation.[12] Perhaps the best-known victim of the tawny owl's fierce attack was the renowned bird photographer Eric Hosking, who lost his left eye when struck by a bird he was attempting to photograph near its nest. He later called his autobiography An Eye for a Bird.[22]

The parents care for young birds for two or three months after they fledge, but from August to November the juveniles disperse to find a territory of their own to occupy. If they fail to find a vacant territory, they usually starve.[6] The juvenile survival rate is unknown, but the annual survival rate for adults is 76.8%. The typical lifespan is five years,[5] but an age of over 18 years has been recorded for a wild tawny owl, and of over 27 years for a captive bird.[12]

Predators of the tawny owl include large birds such as Ural owls, eagle owls, Northern goshawks, golden eagles, and common buzzards. Pine martens may raid nests, especially where artificial nest boxes make the owls easy to find, and several instances have been recorded of Eurasian jackdaws building nests on top of a brooding female tawny owl leading to the death of the adult and chicks.[12] A Danish study showed that predation by mammals, especially red foxes, was an important cause of mortality in newly fledged young, with 36% dying between fledging and independence. The mortality risk increased with fledging date from 14% in April to more than 58% in June, and increasing predation of late broods may be an important selective agent for early breeding in this species.[23]

This species is increasingly affected by avian malaria, the incidence of which has tripled in the last 70 years, in parallel with increasing global temperatures. An increase of one degree Celsius produces a two- to three-fold increase in the rate of malaria. In 2010, the incidence in British tawny owls was 60%, compared to 2–3% in 1996.[24]

Feeding[edit]

The bank vole is a common prey.

The tawny owl hunts almost entirely at night, watching from a perch before dropping or gliding silently down to its victim, but very occasionally it will hunt in daylight when it has young to feed. This species takes a wide range of prey, mainly woodland rodents, but also other mammals up to the size of a young rabbit, and birds, earthworms and beetles. In urban areas, birds make up a larger proportion of the diet, and species as unlikely as mallard and kittiwake have been killed and eaten.[6]

Prey is typically swallowed whole, with indigestible parts regurgitated as pellets. These are medium-sized and grey, consisting mainly of rodent fur and often with bones protruding, and are found in groups under trees used for roosting or nesting.[7]

Less powerful woodland owls such as the little owl and the long-eared owl cannot usually co-exist with the stronger tawny owls, which may take them as food items, and are found in different habitats; in Ireland the absence of the tawny owl allowed the long-eared owl to become the dominant owl. Similarly, where the tawny owl has moved into built-up areas, it tends to displace barn owls from their traditional nesting sites in buildings.[12]

In culture[edit]

A grey individual, probably subspecies S. a. aluco

The tawny owl, like its relatives, has often been seen as an omen of bad luck; William Shakespeare used it as such in Julius Caesar (Act 1 Scene 3): "And yesterday the bird of night did sit/ Even at noon-day upon the market-place/ Hooting and shrieking." John Ruskin is quoted as saying "Whatever wise people may say of them, I at least have found the owl's cry always prophetic of mischief to me".[25]

Wordsworth described the technique for calling an owl in his poem There was a Boy.[26]

And there, with fingers interwoven, both hands
Pressed closely palm to palm and to his mouth
Uplifted, he, as through an instrument,
Blew mimic hootings to the silent owls,
That they might answer him.—And they would shout
Across the watery vale, and shout again,
Responsive to his call,—with quivering peals,
And long halloos, and screams, and echoes loud
Redoubled and redoubled; concourse wild
Of jocund din!

References[edit]

  1. ^ a b BirdLife International (2012). "Strix aluco". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  3. ^ Eurasian Tawny Owl – Strix aluco. The Owl Pages
  4. ^ a b Mullarney, Killian; Svensson, Lars; Zetterstrom, Dan; Grant, Peter J. (1999). Collins Bird Guide. London: HarperCollins. p. 206. ISBN 0-00-219728-6. 
  5. ^ a b c d "Tawny Owl Strix aluco [Linnaeus, 1758]". BirdFacts. British Trust for Ornithology (BTO). Retrieved 31 May 2008. 
  6. ^ a b c d e f g h i j Snow, David; Perrins, Christopher M (editors) (1998). The Birds of the Western Palearctic concise edition (two volumes). Oxford: Oxford University Press. pp. 907–910. ISBN 0-19-854099-X. 
  7. ^ a b Brown, Roy; Ferguson, John; Lawrence, Michael; Lees, David (1987). Tracks and Signs of the Birds of Britain and Europe (Helm Identification Guides). Christopher Helm. p. 86. ISBN 0-7470-0201-0. 
  8. ^ a b c d Burton, Robert (1985). Bird Behaviour. London: Granada Publishing. pp. 44–48. ISBN 0-246-12440-7. 
  9. ^ Hecht, Selig; Pirenne, Maurice Henri (1940). "The sensibility of the nocturnal long-eared owl in the spectrum" (Automatic PDF download). Journal of General Physiology 23 (6): 709–717. doi:10.1085/jgp.23.6.709. PMC 2237955. PMID 19873186. 
  10. ^ a b Martin, Graham R. (August 1977). "Absolute visual threshold and scotopic spectral sensitivity in the tawny owl Strix aluco". Nature 268 (5621): 636–638. doi:10.1038/268636a0. PMID 895859. 
  11. ^ Sinclair, Sandra (1985). How Animals See: Other Visions of Our World. Beckenham, Kent: Croom Helm. pp. 88–100. ISBN 0-7099-3336-3. 
  12. ^ a b c d e f g h i j k l Voous, Karel H.; Cameron, Ad (illustrator) (1988). Owls of the Northern Hemisphere. London, Collins. pp. 209–219. ISBN 0-00-219493-7. 
  13. ^ Based on Güntürkün, Onur, "Structure and functions of the eye" in Sturkie, P. D. (1998). Sturkie's Avian Physiology. 5th Edition. Academic Press, San Diego. pp. 1–18. ISBN 0-12-747605-9. 
  14. ^ Waterton, Charles (1870). Essays on Natural History. Frederick Warne. p. 124. 
  15. ^ Redpath, Stephen M.; Appleby, Bridget M.; Petty, Steve J. (2000). "Do male hoots betray parasite loads in Tawny Owls?". Journal of Avian Biology 31 (4): 457–462. doi:10.1034/j.1600-048X.2000.310404.x. 
  16. ^ (German) Bergmann, Carl (1847). "Über die Verhältnisse der Wärmeökonomie der Thiere zu ihrer Grösse". Göttinger Studien 3 (1): 595–708. 
  17. ^ Brommer, Jon E.; Kari, Ahola ; Karstinen, Teuvo (2005). "The colour of fitness: plumage coloration and lifetime reproductive success in the tawny owl". Proceedings – Royal Society of London. Biological sciences 272 (1566): 935–940. doi:10.1098/rspb.2005.3052. PMC 1564093. PMID 16024349. 
  18. ^ Galeotti, Paolo; Sacchi, Roberto (2003). "Differential parasitaemia in the SNOWY OWLS ®(Strix aluco): effects of colour morph and habitat". Journal of Zoology 261: 91–99. doi:10.1017/S0952836903003960. 
  19. ^ (Latin) Linnaeus, C (1758). Systema naturae per regna tria naturae, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Tomus I. Editio decima, reformata. Holmiae. (Laurentii Salvii). p. 93. "S. capite laevi, corpore ferrugineo, iridíbus atris, remi-gibus primoribus serratís." 
  20. ^ (German) Jánossy D. (1972) "Die mittelpleistozäne Vogelfauna der Stránská skála". In: Musil R. (ed.): "Stránská skála I." Anthropos (Brno) 20: 35–64.
  21. ^ "Tawny Owl Strix aluco". Owl Information. World Owl Trust. Retrieved 6 June 2008. 
  22. ^ Hosking, Eric; Lane, Frank W. (1972). An Eye for a Bird: The Autobiography of a Bird Photographer. London, Hutchinson & Co. p. 20. ISBN 0-09-104460-X. 
  23. ^ Sunde, Peter (September 2005). "Predators control post-fledging mortality in tawny owls, Strix aluco". Oikos 110 (3): 461–472,. doi:10.1111/j.0030-1299.2005.14069.x. 
  24. ^ GaramszegI, László Z (2011). "Climate change increases the risk of malaria in birds". Global Change Biology 17 (5): 1751–1759. doi:10.1111/j.1365-2486.2010.02346.x. 
  25. ^ Armstrong, Edward A. (1958). The Folklore of Birds: An Enquiry into the Origin and Distribution of Some Magico-Religious Traditions. London: Collins. p. 114. 
  26. ^ Wordsworth, William; Coleridge, Samuel Taylor (1800). Lyrical Ballads. London: Longman. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!