Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Distribution

Geographic Range

Coereba flaveola (bananaquit) is common mainly in South America. It is most often found within the range from southern Mexico to northern Argentina and largely eastward throughout South America. It occupies most of the Caribbean Islands and on rare occasions is found in Florida (Merola-Zwartjes 1998).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The tiny adult bananaquit ranges from about 10.5 to 11.5 cm in length. It has a dark, slender, curved beak. Although its plumage varies slightly across its geographic range, the adult plumage is nearly sexually monomorphic. In the male, the feathers on the above side are dark gray, while its crown is more black and the underside/rump is bright yellow. A long, prominent, white eyebrow (supercilium) sits directly above the eye and many times a white spot (speculum) occurs on its generally black wings. The throat is a lighter shade of gray than the back and in certain races the tail-feathers are tipped white. The female bananaquit is very similar, except that her crown is narrowly darker, her throat whitish as opposed to gray, and her rump is more of an olive-yellow shade. The young bananaquit has feathers that are far more dull than its parents' and appear more olive-yellow over its entire body. Certain races of the bananaquit tend to be entirely black, while others lack certain colors or definition in their plumage (Allen 1961; Ridgely and Tudor 1989; Fjeldsa and Krabbe 1990).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The bananaquit covers a range of habitats within its geographical area. The birds are most commonly found at low elevations and rarely in the high mountainous forests. They are present in open fields, areas of cover, the dense, humid rain forests, and even in certain desert areas. Observers have spotted the bananaquit at a variety of elevations, ranging from sea level up to 4000 ft, but is most commonly seen in the lowlands (usually below 760 ft). Although, C. flaveola is present in many habitats, it is most common in the tropical region in areas with some cover (Allen 1961; Wunderle 1984).

Terrestrial Biomes: savanna or grassland ; forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Coereba flaveola, often compared to hummingbirds, takes flower nectar as its primary source of food. Although it does use its sharp beak to pierce flowers from the side to feed, much like some hummingbirds, the bananaquit cannot hover like a hummingbird. For this reason the bird must always perch while feeding and many times hangs upside down from a branch instead of sitting upright. In addition to nectar, it eats a number of other food items that include fruits, insects, and other small arthropods. The bananaquit enjoys many kinds of fruit, including ripe bananas. It may also pick small insects from the undersides of leaves and eats flies, beetles, caterpillars, ants, bees, and spiders (Allen 1961; Skutch and Stiles 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Coereba flaveola (bananaquit) is prey of:
Buteo jamaicensis
Felis silvestris catus
Accipiter striatus
Diptera
Secernentia nematodes
Falco sparverius

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Coereba flaveola (bananaquit) preys on:
Araneae
Pseudoscorpionida
Coleoptera
Thysanoptera
Auchenorrhyncha
Sternorrhyncha
Lepidoptera
Stylomatophora
nectar
seeds
Hemiptera
Hymenoptera
Diptera
nectar and floral

Based on studies in:
Puerto Rico, El Verde (Rainforest)

This list may not be complete but is based on published studies.
  • Waide RB, Reagan WB (eds) (1996) The food web of a tropical rainforest. University of Chicago Press, Chicago
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Average lifespan

Status: wild:
83 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 6.9 years (wild) Observations: Not much is known about the longevity of these animals. Maximum longevity from banding studies is 6.9 years (http://www.pwrc.usgs.gov/BBL/homepage/longvrec.htm), but possibly they can live significantly longer.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Reproduction varies slightly among the subspecies of C. flaveola. Typically, though, the bananaquit will raise several broods within a year and generally the breeding season lasts for five months. In certain areas the bananaquit breeds at the end of the dry season (March through early August). Breeding is also often synchronized with the first rains early in the wet season. Other times, though, breeding does not show any relationship to the seasonal weather patterns.

Bananaquit broods may contain from one to three eggs. The eggs themselves are a white-cream color (sometimes pinkish) with brown/salmon spots that vary in distribution (Allen 1961; Wunderle 1984).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Coereba flaveola

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 52 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ATGACATTCGTTACCCGATGATTATTCTCAACCAATCACAAAGACATTGGAACCCTGTACCTAATCTTCGGTGCATGAGCCGGAATAGTAGGCACAGCCCTAAGCCTCCTCATTCGATCAGAGCTAGGTCAACCCGGAGCTCTCCTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCACGCCTTTGTAATAATCTTCTTCATAGTTATACCAATCATGATTGGAGGCTTTGGTAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTTCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTTCTCCTCCTCCTAGCATCTTCCACAGTTGAAGCAGGCGTCGGCACCGGTTGAACAGTATATCCCCCATTAGCCGGCAACCTAGCCCATGCCGGAGCATCAGTAGACCTGGCAATCTTCTCCCTTCACCTGGCCGGAATTTCCTCAATCCTAGGAGCAATCAACTTCATCACAACTGCCGTCAATATGAAACCCCCTGCCCTCTCACAATACCAAACCCCCCTATTCGTCTGATCCGTCCTAATCACCGCAGTCCTGCTACTCCTATCCCTCCCAGTCCTAGCTGCTGGAATTACAATACTCCTTACAGACCGCAACCTTAATACTACATTCTTCGACCCTGCAGGGGGAGGAGACCCAGTCCTATATCAACACCTTTTCTGATTCTTCGGACACCCAGAAGT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Coereba flaveola

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 54
Specimens with Barcodes: 109
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Coereba flaveola does not appear to be endangered in any way across its geographic range. It is a rather abundant species in the areas in which it occurs.

US Federal List: no special status

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Bananaquits often get to flower nectar through the side of the flower. It pierces the flower and retrieves the nectar for its own benefit. This means that the flower is either left unpollinated or will die (Skutch and Stiles 1989).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Coereba flaveola does not benefit humans in many ways. Recent studies have shown that bananaquits, in addition to hummingbirds, pollinate at least three species of Bromelioideae (a subfamily of bromeliad plants).

Peurto Rico has adopted the bananaquit as its national bird, and many Caribbean and South American countries have featured the bird on their postage stamps (Sazima and Sazima 1999).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Bananaquit

The bananaquit (Coereba flaveola) is a species of passerine bird of uncertain relation. It is tentatively placed in the tanager family, but classified as incertae sedis by other authorities such as the American Ornithologists' Union. Its classification is debated, and it is often placed in its own family: Coerebidae. It has recently been suggested the bananaquit should be split into three species, but this has yet to receive widespread recognition. This small, active nectarivore is found in warmer parts of the Americas, and is generally common.

Taxonomy[edit]

The bananaquit was first described by Linnaeus in his Systema Naturae in 1758 as Certhia flaveola.[2] It was reclassified as the only member of the genus Coereba by Louis Jean Pierre Vieillot in 1809.[3] Prior to 2005, the bananaquit was assigned to the monotypic family Coerebidae; there is currently no agreement to which family it belongs; some authors place it into the Emberizidae.[4] Since recent studies have shed some light on the bananaquit's affinities, many authorities consider Coerebidae an obsolete taxon. The Coerebidae used to contain other nectar-eating birds from the tropical Americas, but these have since been moved. The bananaquit is part of a group that includes Darwin's finches, Tiaris (grassquits), Loxigilla, etc.—most of which were previously placed in Emberizidae, but are now known to actually be part of the Thraupidae.[5] As such this species is tentatively placed in the Thraupidae family unless a study suggests more accurate placement. Nevertheless, its precise relations remain unresolved, so the American Ornithologists' Union classes it as a species incertae sedis.[6]

It is still unclear if any of the island subspecies should be elevated to species, but phylogenetic studies have revealed three clades: the nominate group from Jamaica, Hispaniola and the Cayman Islands, the bahamensis group from the Bahamas and Quintana Roo, and the bartholemica group from South and Central America, Mexico (except Quintana Roo), the Lesser Antilles and Puerto Rico.[7][8] Several taxa were not sampled,[7][8] but most of these are easily placed in the above groups based on zoogeography alone. Exceptions are oblita (San Andrés Island) and tricolor (Providencia Island), and their placement is therefore uncertain. In February 2010, the International Ornithological Congress listed bahamensis and bartholemica as proposed splits from C. flaveola.[9]

The Bahamas bananaquit with a whitish throat and upper chest may be a separate species
Illustration by Joseph Smit, 1886

Subspecies[edit]

There are 41 currently recognized subspecies:[10]

  • C. f. bahamensis(Reichenbach, 1853): Bahamas
  • C. f. caboti(Baird, 1873): east Yucatan Peninsula and nearby islands
  • C. f. flaveola(Linnaeus, 1758): nominate, Jamaica
  • C. f. sharpei(Cory, 1886): Cayman Is.
  • C. f. bananivora(Gmelin, 1789): Hispaniola and nearby islands
  • C. f. nectareaWetmore, 1929: Tortue I.
  • C. f. portoricensis(Bryant, 1866): Puerto Rico
  • C. f. sanctithomae(Sundevall, 1869): north Virgin Is.
  • C. f. newtoni(Baird, 1873): St. Croix (south Virgin Is.)
  • C. f. bartholemica(Sparrman, 1788): north and central Lesser Antilles
  • C. f. martinicana(Reichenbach, 1853): Martinique and St. Lucia (south central Lesser Antilles)
  • C. f. barbadensis(Baird, 1873): Barbados
  • C. f. atrata(Lawrence, 1878): St. Vincent (south Lesser Antilles)
  • C. f. aterrima(Lesson, 1830): Grenada and the Grenadines (south Lesser Antilles)
  • C. f. uropygialisvon Berlepsch, 1892: Aruba and Curaçao (Netherlands Antilles)
  • C. f. tricolor(Ridgway, 1884): Providencia I. (off east Nicaragua)
  • C. f. oblitaGriscom, 1923: San Andrés I. (off east Nicaragua)
  • C. f. mexicana(Sclater, 1857): southeastern Mexico to western Panama
  • C. f. cerinoclunisBangs, 1901: Pearl Is. (south of Panama)
  • C. f. columbiana(Cabanis, 1866): eastern Panama to southwestern Colombia and southern Venezuela
  • C. f. bonairensisVoous, 1955: Bonaire I. (Netherlands Antilles)
  • C. f. melanornisPhelps & Phelps, 1954: Cayo Sal I. (off Venezuela)
  • C. f. lowiiCory, 1909: Los Roques Is. (off Venezuela)
  • C. f. ferryiCory, 1909: La Tortuga I. (off Venezuela)
  • C. f. frailensisPhelps & Phelps, 1946: Los Frailes and Los Hermanos Is. (off Venezuela)
  • C. f. lauraeLowe, 1908: Los Testigos (off Venezuela)
  • C. f. luteola(Cabanis, 1850): coastal northern Colombia and Venezuela, Trinidad and Tobago
  • C. f. obscuraCory, 1913: northeastern Colombia and western Venezuela
  • C. f. minima(Bonaparte, 1854): eastern Colombia and southern Venezuela to French Guiana and north central Brazil
  • C. f. montanaLowe, 1912: Andes of northwestern Venezuela
  • C. f. caucaeChapman, 1914: western Colombia
  • C. f. gorgonaeThayer & Bangs, 1905: Gorgona I. (off western Colombia)
  • C. f. intermedia(Salvadori & Festa, 1899): southwestern Colombia, western Ecuador and northern Peru east to southern Venezuela and western Brazil
  • C. f. bolivariZimmer & Phelps, 1946: eastern Venezuela
  • C. f. guianensis(Cabanis, 1850): southeastern Venezuela to Guyana
  • C. f. roraimaeChapman, 1929: tepui regions of southeastern Venezuela, southwestern Guyana and northern Brazil
  • C. f. pacificaLowe, 1912: eastern Peru
  • C. f. magnirostris(Taczanowski, 1880): northern Peru
  • C. f. disparZimmer, 1942: north central Peru to western Bolivia
  • C. f. chloropyga(Cabanis, 1850): east central Peru to central Bolivia and east to eastern Brazil, nortehrn Uruguay, northeastern Argentina and Paraguay
  • C. f. alleniLowe, 1912: eastern Bolivia to central Brazil

Description[edit]

The bananaquit is a common visitor to bird tables and hummingbird feeders. The north Lesser Antillean bartholemica is among the subspecies with the darkest throat

The bananaquit is a small bird, although there is some degree of size variation across the various subspecies. Length can range from 4 to 5 in (10 to 13 cm).[11][12] Weight ranges from 5.5 to 19 g (0.19 to 0.67 oz).[13][14]

Most subspecies of the bananaquit have dark grey (almost black) upperparts, black crown and sides of the head, a prominent white eyestripe, grey throat, white vent, and yellow chest, belly and rump.

The sexes are alike, but juveniles are duller and often have a partially yellow eyebrow and throat.

In the subspecies bahamensis and caboti from the Bahamas and Cozumel, respectively, the throat and upper chest are white or very pale grey,[15][16] while ferryi from La Tortuga Island has a white forehead.[17] The subspecies laurae, lowii and melanornis from small islands off northern Venezuela are overall blackish,[17] while the subspecies aterrima and atrata from Grenada and Saint Vincent have two plumage morphs, one "normal" and another blackish.[15] The pink gape is usually very prominent in the subspecies from islands in the Caribbean Sea.

Behaviour[edit]

A bananaquit feeding on an orange in the Morne Diablotins National Park in Dominica

The bananaquit has a slender, curved bill, adapted to taking nectar from flowers. It sometimes pierces flowers from the side, taking the nectar without pollinating the plant.[18] It also feeds on sweet juices by puncturing fruit with its beak, and will eat small insects on occasion. While feeding, the bananaquit must always perch as it cannot hover like a hummingbird.[19]

The bananaquit is known for its ability to adjust remarkably to human environments. It often visits gardens and may become very tame. Its nickname, the sugar bird, comes from its affinity for bowls or bird feeders stocked with granular sugar, a common method of attracting these birds.[19] The bananaquit builds a spherical lined nest with a side entrance hole, laying up to three eggs, which are incubated solely by the female.[4] It may also build its nest in man-made objects, such as lampshades and garden trellises. The birds breed all year regardless of season and build new nests throughout the year.[19]

Distribution[edit]

Bananaquit in its nest. Osa Peninsula, Costa Rica

It is resident in tropical South America north to southern Mexico and the Caribbean. It is found throughout the West Indies, except Cuba.[15] Birds from the Bahamas are rare visitors to Florida.[18] It is particularly prevalent on Aruba, Bonaire and Curaçao and also the most popular species of bird on the islands.[19]

It occurs in a wide range of open to semi-open habitats, including gardens and parks, but it is rare or absent in deserts, dense forests (e.g. large parts of the Amazon rainforest) and at altitudes above 2,000 m (6,600 ft).[17]

References[edit]

  1. ^ BirdLife International 2012
  2. ^ Linnaeus 1758, p. 119
  3. ^ Vieillot 1809, p. 70
  4. ^ a b Monteiro Pereira 2008, p. 120
  5. ^ Burns, Hackett & Klein 2002
  6. ^ American Ornithologists' Union 2008
  7. ^ a b Seutin et al. 1994
  8. ^ a b Bellemain, Bermingham & Ricklefs 2008
  9. ^ "Updates: Candidates". IOC World Bird List. Retrieved 21 October 2011. 
  10. ^ Gill, F.; Donsker, D., eds. (2014). "Bananaquit, buntings, sparrows & bush tanagers". IOC World Bird List (v 4.2). doi:10.14344/IOC.ML.4.2. Archived from the original on 26 July 2014. Retrieved 26 July 2014. 
  11. ^ "Bananaquit". anywherecostarica.com. Retrieved 21 October 2011. 
  12. ^ "Bananaquit". enature.com. Retrieved 21 October 2011. 
  13. ^ "Bananaquits". birdingguide.com. Retrieved 21 October 2011. 
  14. ^ Diamond 1973
  15. ^ a b c Raffaele et al. 1998
  16. ^ Howell & Webb 1995
  17. ^ a b c Restall, Rodner & Lentino 2006
  18. ^ a b Dunning 2001
  19. ^ a b c d De Boer 1993, p. 105

Literature cited[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!