Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Longueur : mâle 16 à 17 cm et femelle 18 à 19 cm, envergure : 35 cm environ pour le mâle et 38 cm environ pour la femelle, poids : 59 g en moyenne pour les mâles et entre 63 et 103 g pour les femelles selon la saison.

La Chevêchette d’Europe ressemble à un gros moineau avec une tête ronde à quasi carrée selon l’humeur et de petits yeux jaunes orangés surmontés de sourcils blancs. Le dessus est brun foncé parsemé de petites tâches blanches et le dessous est blanc strié de brun. Sa queue brune dépasse nettement de la pointe des ailes et présente 5 minces barres blanches et peut être relevée à la verticale, ce qui est caractéristique de l’espèce. En vol sa silhouette est marquée par des ailes courtes et obtuses et une queue arrondie.

La population française est sédentaire mais une partie des femelles manifeste un certain erratisme. Certains individus peuvent transhumer à la mauvaise saison jusqu’à la limite inférieure des forêts voire jusqu’à la plaine. Les populations du nord de la Scandinavie et de la Russie ont tendance à effectuer de vraies migrations se traduisant par des « invasions » dans les populations méridionales.

La Chevêchette d’Europe, dite « rapace nocturne », est pourtant surtout diurne. Ses deux pics d’activités s’observent essentiellement le soir et le matin avec une activité qui se prolonge le jour et elle dort la nuit.

La Chevêchette d’Europe effectue des mouvements vifs, parfois saccadés et pressés. Son vol est rapide et en dents de scie sur les longs trajets. Elle chasse à l’affût et peut aussi capturer des oiseaux en vol ou dans leur gîte nocturne. Elle se nourrit surtout de micromammifères et aussi de passereaux en hiver. Ses pelotes de réjection mesurent en moyenne 28 mm de long et 12 mm de diamètre. Les nombreuses morsures sur les os de ses proies permettent de les reconnaître.

La Chevêchette d’Europe est relativement agressive et associable. Les adultes appariés s’évitent et utilisent des reposoirs séparés. Les parades et accouplements se déroulent à partir de fin février à début avril. C’est ensuite la femelle qui couve 5 à 7 œufs et le mâle apporte les proies.

La taille du domaine vital dépend de la qualité du milieu (notamment la quantité de cavités) et varie aussi au cours de l’année. Dans le Vercors, la surface pour un mâle a été estimée à 0,93 km² en moyenne avec une augmentation significative entre la période pré-reproduction (0,2 km²) et post-reproduction avant l’envol (0,83 km²) ; la femelle utilise un territoire de 3 ha autour de la cavité de reproduction.

Les poussins quittent la cavité à l’âge de 28 à 32 jours en étant capables de voler et de parcourir déjà une assez grande distance. La famille reste unie pendant 4 semaines, nourrie par les parents. Les jeunes dispersent à l’automne : les femelles à 17 km environ et les mâles à 12 km environ mais les mâles se cantonnent ensuite alors que les femelles restent vagabondent.

La Chevêchette d’Europe fréquente les forêts peuplées de vieux arbres, principalement de conifères et parfois les Hêtraies-Sapinières. Elle évite les forêts trop denses et uniformes car elle nécessite des terrains de chasse de type clairières, sous-bois, bordures de tourbières hautes. Elle utilise des trous de pics pour se reproduire, s’alimenter et stocker ses proies ; surtout de Pic épeiche, Pic épeichette, Pic tridactyle ou Pic cendré.

Manifestation vocale : Voix mélodieuse avec des notes sifflantes et grinçantes, en même temps monotone en raison d’un répertoire assez limité. Chant territorial du mâle composé d’une série uniforme de sons sifflants, diu, d’une fréquence quasi constante et le plus souvent sans harmonique.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Glaucidium passerinum

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTTTCTCCAACCCACAAAGACATTGGCACCCTCTATCTAATCTTCGGCGCATGGGCTGGCATAGTGGGAACAGCCCTCAGCCTCCTAATCCGAGCCGAACTGGGACAGCCGGGAACACTCCTAGGTGATGACCAAATCTATAATGTAATCGTTACTGCCCACGCCTTCGTAATAATTTTCTTCATGGTCATACCAATTATGATTGGGGGCTTTGGAAACTGACTAGTCCCACTAATAATCGGGGCCCCAGACATGGCCTTCCCTCGCATAAACAACATAAGCTTCTGACTCCTGCCACCCTCTTTTATCCTCCTCTTGGCCTCCTCTACGGTAGAGGCTGGAGCAGGCACTGGCTGAACAGTATACCCACCCCTGGCCAGTAACCTAGCCCATGCCGGGGCTTCAGTCGACTTGGCCATCTTCTCCCTCCACCTTGCTGGGGTATCATCCATCCTGGGGGCCATTAACTTCATTACAACCGCCATCAACATAAAACCCCCGTCCCTATCGCAATACCAAACTCCCCTATTCGTATGATCCGTACTTATTACCGCAATTCTCCTACTTCTCTCTCTCCCAGTACTAGCAGCAGGAATTACCATACTCTTAACAGATCGCAACCTAAACACCACATTCTTTGACCCAGCTGGCGGTGGTGACCCGATCCTGTATCAACACCTATTCTGATTCTTCGGACACCCAGAAGTTTACATCCTAATCCTACCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Glaucidium passerinum

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be fluctuating, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 47,000-110,000 breeding pairs, equating to 141,000-330,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 300,000-1500,000 individuals, although further validation of this estimate is needed. National population sizes have been estimated at < c.100 breeding pairs in China and possibly c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian pygmy owl

The Eurasian pygmy owl, Glaucidium passerinum, is the smallest owl in Europe. These owls are a dark reddish to greyish-brown, with spotted sides and half of a white ring around the back of their neck.[2]

The owl preys on birds – some nearly as large as itself – and small mammals, such as voles.

It is found in the boreal forests of Northern and Central Europe to Siberia,[2] usually at the edges of clearings. It nests in old woodpecker holes, often those of the great spotted woodpecker.

This is a sedentary species, meaning that adults are resident throughout the year in its range. The exception would be during harsh winters, when the adults may move south. Young of the species usually move in autumn or winter.[2] In the wild Eurasian pygmy owls may live six to seven years and sometimes even longer in captivity.

This starling-sized bird hunts at dawn, dusk, and even daytime,[2] rather than in total darkness.

Habitat[edit]

Eurasian pygmy owls can be found primarily in coniferous forests of the taiga and higher mountainous regions with coniferous and mixed forests. These areas generally have cooler temperatures and higher rainfall than nearby lowland regions. Eurasian pygmy owls' nest sites are often surrounded by moist or swampy land, in groups of young spruces with a water source nearby. They nest in tree cavities, usually being old woodpecker holes.

Description[edit]

The Eurasian pygmy owl is usually red tinged to a grayish-brown with dots on his/her back. The tail is generally darker than the body with 5 narrow, whitish bars. In order to be able to carry larger vertebrate prey, they have adapted disproportionately large feet. The pygmy owl has a small, short head with white to gray eyebrows and yellow eyes. However, it has no ear tufts like most other owls. There is a white half collar on the back of the neck. The belly is mostly white with brown speckles. The beak of the Eurasian pygmy owl is a grayish yellow and hook shaped. The legs and toes are a brownish-yellow with black talons. Female owls are generally bigger than the males. The length of the males is about 15.2 to 17 cm (6-6.7"), and the length of females is anywhere from 17.4 to 19 cm (6.8-7.5"). Males weigh about 50-65g (1.76-2.3 oz), and females weigh about 67 to 77g (2.36-2.7 oz).

Call[edit]

The call of the Eurasian pygmy owl is much higher pitched than what is generally perceived as a normal owl “hooting” sound. The call almost sounds squeaky. The male’s normal call is quite monotonous. It consists of clear, fluted notes spaced by about two seconds. The females' call is similar to the males', the only difference being that the female call is higher pitched. Before and after the mating season, both males and females make a five to seven note rise on the pitch scale.

Breeding[edit]

Chicks in a nest box

Eurasian pygmy owls nest in tree cavities; many times in old woodpecker holes. The trees are usually coniferous like the forests in which they prefer to live. Although, in some cases they will also nest in birch and beech trees. The owls form mating pairs in autumn and late winter/early spring. As a courtship ritual, the male leads the female around and shows her his territory. If the male uses the same nest as the previous breeding season, then this will be the only one he shows her. The male will also feed the female.

Eurasian pygmy owls are serially monogamous, meaning that they only have one mate at a time; therefore, the two owls may pair for more than one breeding season. The male Eurasian pygmy owls are very territorial and may use the same nesting territory for up to 7 years. The female lays about four to seven eggs around the first half of April. Their incubation period is four weeks and is said to begin when the third egg is laid. The eggs hatch all around the same time and the female cares for them for the next nine to ten days. During this time, the male continues to feed the female pygmy owl. After three weeks, the young begin to look out of the nest and the female only enters the nest to bring them food or clean out waste. After thirty to thirty four days, the young leave the nest. After leaving the nest, offspring remain close for several more days for food and guidance, and then depart to find their own territory.

Hunting/food[edit]

The diet of the Eurasian pygmy owl includes mostly small vertebrate mammals like voles, lemmings, and mice. They may also catch small birds like thrushes, crossbills, chaffinches, and leaf-warblers. They are even able to catch these prey birds in flight sometimes. Other prey may include small lizards, bats, fish, and insects. During the winter months, the owls may store food in tree cavities. Because these small owls lack the ability to fly silently, they are mostly diurnal. This means that they are mostly active during the daytime, a unique trait since most people think of all owls as being nocturnal creatures. This is advantageous because much of their prey is also diurnal. The owls are most active just before sunrise and shortly after sunset.

Location[edit]

The Eurasian pygmy owl can be found in Northern and Central Europe, and east to Siberia. Adult owls may move south in severe winter months. Adolescents are found moving around in fall and winter.

References[edit]

  1. ^ BirdLife International (2012). "Glaucidium passerinum". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d "Eurasian Pygmy Owl - Glaucidium passerinum". The Owl Pages. 2006. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!