Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Comprehensive Description

Longueur moyenne : 61 cm (mâles) à 67 cm (femelles), envergure moyenne : 157 cm (mâles) à 168 cm (femelles), poids : 1 600 à 2 800 g pour les mâles et 1 800 à 4 200 g pour les femelles.

Le Grand-duc d’Europe possède un corps massif : c’est le plus grand rapace nocturne du monde et il est deux fois plus gros qu’une Chouette hulotte. Il se distingue par sa grosse tête ornée d’aigrettes de 8 cm de long et par ses grands yeux jaune orange. Le plumage est brun-roux tacheté et barré de sombre sur le dessus. Le dessous est rouille couvert de raies brun foncé finement barrées de sombre. Quand l’oiseau émet un appel bec fermé, sa gorge enfle et fait apparaître une tâche blanche qui agit comme un signal optique dans l’obscurité. En vol, les ailes sont longues et larges.

Sur une courte distance, le Grand-duc d’Europe se déplace par bonds en retombant lourdement sur ses pattes. En vol, il est très agile et peut être rapide malgré sa taille. Il vole généralement au ras du sol dans les milieux ouverts mais peut aussi survoler les larges vallées à grande hauteur.

La phase d’activité commence au crépuscule puis se poursuit la nuit avec une baisse après minuit. Selon le contexte (site tranquille) et la période (famine, nourrissage des jeunes), ils peuvent être actifs le jour.
Les Grands-ducs sont très tolérants entre eux. Seul un territoire proche du nid est défendu. Le Grand-duc est en revanche très agressif à l’égard des autres rapaces diurnes et nocturnes.

Les couples se forment en octobre. En dehors de la parade nuptiale qui a lieu en février/mars, les conjoints ne cherchent pas un contact étroit, possèdent des reposoirs séparés et volent chacun de leur côté. La femelle pond 2 ou 3 œufs qu’elle couve seule pendant 34 jours. Selon son emplacement, les poussins quittent ensuite le nid entre l’âge de 3,5 (nid au sol) à 10 semaines (paroi rocheuse). Les premières tentatives de vol ont lieu vers la 8ème semaine. Ils acquièrent une autonomie de chasse après l’âge de 80 jours et à ce moment-là ils dispersent, sur 50 km en moyenne.

Les rongeurs tiennent une part importante du régime alimentaire. Cependant, cet oiseau est opportuniste, il s’attaque en priorité aux proies « faciles » (vertébrés affaiblis, blessés, charognes, ...). Il est capable de prélever des corvidés, rapaces diurnes et nocturnes, pigeons, hérissons, lagomorphes. En fonction du contexte, il peut capturer aussi des renards, chauves-souris, grenouilles, lézards, poissons, invertébrés. Il peut chasser à l’affut, en rase-motte, le long de parois rocheuses voire à pied. Ses pelotes de réjection mesurent en moyenne 72 mm de long et 34 mm de diamètre ; compte tenu de leur taille, elles ne peuvent être confondues avec celles d’aucun autre rapace nocturne.

Le Grand-duc d’Europe est une espèce sédentaire. Il utilise toujours les mêmes lieux pour dépecer ses proies et les entreposer. Néanmoins, la fidélité au territoire ainsi qu’au couple ne durent pas toute la vie.

Le Grand-duc d’Europe fréquente des habitats très variés : les falaises jouxtant les grandes étendues d’eau, les bords de mer, les garrigues du bassin méditerranéen. Il chasse essentiellement en milieu ouvert ou peu boisé. Pour nicher, il préfère les parois rocheuses et les carrières pourvues de cavités et de surplombs. Il recherche généralement la proximité de l’eau pour boire, se baigner et y trouver de nombreuses proies.

Manifestation vocale : Chant territorial du mâle puissant mais étouffé composé de deux syllabes bouho avec accent sur la première. Chant de la femelle, ouhyou, plus aigu plus pressé et plus rauque avec une tonalité moins fluctuante.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Muséum national d'Histoire naturelle. Service du Patrimoine naturel

Source: Inventaire National du Patrimoine Naturel

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Eagle owls primarily live in the Palearctic region, although they can travel as far south as the Oriental Region and Ethiopian Region and as far north as the far reaches of Siberia. They are found in North Africa, Europe, The Middle East, and Asia.

Biogeographic Regions: palearctic ; oriental ; ethiopian

Other Geographic Terms: holarctic ; cosmopolitan

  • Centre for the Conservation of Specialized Species. 2002. "The Eurasian Eagle Owl" (On-line ). The Centre for the Conservation of Specialized Species. Accessed 3/21/03 at http://www.conservationcentre.org/scase21.html.
  • Konig, C., J. Becking, F. Weick. 1999. Owls: A Guide to the Owls of the World. New York, NY: Yale University Press.
  • Parry-Jones, J. 1998. Understanding Owls: Biology, Management, Breeding, Training. New York, NY: David and Charles.
  • The Peregrine Fund. 2003. "Eurasian Eagle Owl" (On-line). The Peregrine Fund. Accessed March 21, 2003 at http://www.peregrinefund.org/Explore_Raptors/owls/eagleowl.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eagle owls are the largest owls in the world, and they are best known for their large, striking, orange eyes. They are often called the Old World version of America's widely distributed great horned owl. They have prominent ear tufts and are primarily brown-black and tawny-buff in color. Their facial disk is heavily marked with black, gray, and white. Their upper parts are darker than their lower parts, which have black streaks, and their throat is white. It is interesting to note that these owls become paler in the northeastern geographic regions and get progressively darker as you move to the Pacific coast. Also, size tends to decrease from north to south, and east to west.

Range mass: 1600 to 4200 g.

Average mass: 2800 g.

Range length: 58 to 71 cm.

Average length: 65 cm.

Range wingspan: 1.5 to 2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

These owls can be found in many different kinds of habitats including wooded areas (coniferous forests), warm deserts, mountain ranges, and riverbeds. They prefer to live in rocky landscapes, especially when nesting. Eagle owls search for habitats with adequate food supply and proper nesting sites. Their habitats vary greatly, and they can also be found in open areas that have few trees like farmlands and grasslands.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; forest ; scrub forest ; mountains

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eagle owls are carnivores. They are primarily nocturnal hunters and have various hunting techniques. They take their prey in flight or on the ground. They prefer to hunt in open spacious locations rather than forests. Most owls are very capable hunters and the eagle owl is no exception. Owl wings have evolved to make very little noise when flapping. With their night vision, advanced hearing, and silent flight they are the hit men of their territory. Their prey usually has no idea they were being stalked. They feed on almost anything they can catch including rats, mice, voles, beetles and even large prey like deer fawns and foxes. They will also feed on other birds such as crows, ducks, and even other owls. Dominant prey can vary from habitat to habitat but is most often small rodents.

Animal Foods: birds; mammals; reptiles; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eagle owls are at the top of their food chain. They are particularly useful in keeping the number of rodents down in their various ecosystems. The removal of this species can cause the rodent population in a given area to grow significantly. Therefore, they may be a keystone predator.

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Once eagle owls reach adulthood, they are at a very low risk of predation. They are at the top of the food chain in their niche. They are not a major food source for any other species. The only time they are at risk of predation is during their early years. They are at risk from any predator too large for them too eat. Fortunately, the mother stays with the young for most of this period and keeps the predators at bay. Due to their striped, spotted, and varied coloring, they are extremely well camouflaged, especially when perching in the trees.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Bubo bubo preys on:
Tyto alba
Dryomys nitedula

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eagle owls are known for their loud calls. They are heard far more than they are seen. They use their various hoots and clucks to let others know they have entered or are entering certain territories. Different hoots represent different moods and are easily recognizable between each member of the species. Also, eagle owls are able to decipher the size and distance of intruders based on the intensity of their call. They also use a low gutteral hoot to attract mates. It's interesting to note that even though eagle owls are difficult to study, they (like other owls) cough up what is known as an owl pellet after their stomach goes through the digestive process. These owl pellets contain the hair, feathers, and bones of prey they were unable to digest. These pellets are very useful to scientists because they help them understand the food habits of these elusive birds.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; vibrations ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Eagle owls have relatively long life spans once they reach adulthood. They have no real natural enemies. In the wild, they live for approximately 20 years, but they can live more than 60 years in captivity.

Range lifespan

Status: wild:
68 (high) years.

Range lifespan

Status: captivity:
64 (high) years.

Typical lifespan

Status: wild:
10 to 20 years.

Typical lifespan

Status: captivity:
20 to 60 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 68 years (captivity) Observations: In captivity these animals may live over 60 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Both sexes are usually solitary but they pair up during courtship. They advertise potential breeding sites by digging a shallow depression into the earth and emitting a light staccato note and various clucking sounds. They also use these calls to keep track of their mate's location. People often hear them calling to each other. They keep the same partners for life. Eagle owls are very sensitive to their environment. If there is not enough food resources, will mate at a much slower rate and later into the year. When they have sufficient habitats and plentiful food, their mating rate increases significantly.

Mating System: monogamous

Eagle owls form pairs in early fall and nest in late January and early February. They prefer to nest in crevices between rocks, sheltered cliff ledges, cave entrances, as well as abandoned nests of other large birds. Usually egg laying begins in late winter. They usually have one batch of eggs per year ranging from one to four white eggs. This number depends on the food availiable in their area. When the owlets hatch, they are brooded for about two weeks. In about three weeks the young begin to feed and swallow by themselves. By week five they can walk around the nesting area and begin to fly about 60 days, although for only a few meters. They leave the nest or are driven out in the fall (Sept-Nov.) Eagle owls are able to breed from the ages of 2-31 years.

Breeding interval: Breeding occurs once a year.

Breeding season: The breeding season lasts from December to April.

Range eggs per season: 1 to 4.

Average eggs per season: 3.

Range time to hatching: 2 to 3 months.

Range fledging age: 20 to 24 weeks.

Range time to independence: 9 to 12 months.

Range age at sexual or reproductive maturity (female): 1 to 3 years.

Range age at sexual or reproductive maturity (male): 1 to 3 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; fertilization ; oviparous

Once the eggs are laid, they are incubated by the female alone. The male kills prey and feeds his mate. Once the eggs hatch, the male continues to bring food to the female for the next two weeks. During this time the female stays at the nest protecting her young from predators and teaching them how to eat on their own. All owls are imprinted by their mothers, which means they will imitate the first animal they see. This makes it difficult to release owls into captivity if they are not raised by an owl parent. If an owl sees a human when they are born, they think they are human too.

Parental Investment: male parental care ; female parental care

  • Centre for the Conservation of Specialized Species. 2002. "The Eurasian Eagle Owl" (On-line ). The Centre for the Conservation of Specialized Species. Accessed 3/21/03 at http://www.conservationcentre.org/scase21.html.
  • Konig, C., J. Becking, F. Weick. 1999. Owls: A Guide to the Owls of the World. New York, NY: Yale University Press.
  • Parry-Jones, J. 1998. Understanding Owls: Biology, Management, Breeding, Training. New York, NY: David and Charles.
  • Penteriani, V., M. Gallardo, P. Roche. 2002. Landscape structure and food supply affect eagle owl (Bubo bubo) density and breeding performance: a case of intra-population heterogeneity. Journal of Zoology, 257: 365-372.
  • The Peregrine Fund. 2003. "Eurasian Eagle Owl" (On-line). The Peregrine Fund. Accessed March 21, 2003 at http://www.peregrinefund.org/Explore_Raptors/owls/eagleowl.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubo bubo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCACAAAGACATTGGCACCCTCTACCTAATCTTCGGGGCATGAGCAGGCATAGTTGGCACTGCCCTCAGCCTACTTATCCGAGCCGAACTCGGCCAACCCGGGACCCTTCTTGGCGACGACCAAATCTACAACGTAGTTGTCACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTCATACCCATCATGATCGGAGGATTTGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCCTTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCACCCTCACTCCTACTCCTACTAGCCTCCTCCACTGTAGAAGCCGGAGCGGGCACCGGATGAACCGTCTACCCCCCATTAGCTGGCAACCTAGCCCATGCCGGCGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACTTGGCTGGAGTATCATCCATCCTAGGGGCAATTAACTTCATCACCACTGCCATTAACATAAAACCCCCGGCGCTCTCACAATACCAAACCCCCCTATTTGTATGATCTGTCCTCATCACCGCCATTCTCCTCCTACTATCCCTCCCAGTTCTCGCCGCCGGCATTACCATACTACTAACCGACCGCAACTTAAACACCACATTCTTCGACCCCGCCGGAGGGGGCGACCCAATCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTTGGAATTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Bubo bubo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 11
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Eagle owls are considered rare but not yet threatened. Their numbers are steadily declining due to habitat loss from human encroachment.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii; appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 19,000-38,000 breeding pairs, equating to 57,000-114,000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 250,000-2,500,000 individuals, although further validation of this estimate is needed. National population estimates include: c.100-10,000 breeding pairs in China; c.100-10,000 breeding pairs in Korea; < c.100 breeding pairs in Japan and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse affects of the eagle owl on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eagle owls are economically beneficial to farmers that want to keep the number of rodents down on their land. Many birdwatchers will also pay to get a glimpse of this rare bird in its natural habitat as well as in zoos.

Positive Impacts: ecotourism ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eurasian eagle-owl

The Eurasian eagle-owl (Bubo bubo) is a species of eagle-owl resident in much of Eurasia. It is sometimes called the European eagle-owl and is, in Europe, where it is the only member of its genus besides the snowy owl (B. scandiacus), occasionally abbreviated to just eagle-owl. In India, it is often called the Indian great horned owl, though this may cause confusion with the similarly named American bird.[3] It is one of the largest species of owl, and females can grow to a total length of 75 centimetres (30 in), with a wingspan of 188 centimetres (74 in), males being slightly smaller. This bird has distinctive ear tufts, the upper parts are mottled black and tawny and the wings and tail are barred. The underparts are buff, streaked with darker colour. The facial disc is poorly developed and the orange eyes are distinctive.

The Eurasian eagle-owl is found in a number of habitats but is mostly a bird of mountain regions, coniferous forests, steppes and remote places. It is a mostly nocturnal predator, hunting for a range of different prey species, predominately small mammals but also birds of varying sizes, reptiles, amphibians, fish, large insects and earthworms. It typically breeds on cliff ledges, in gullies, among rocks or in some other concealed location. The nest is a scrape in which up to six eggs are laid at intervals and which hatch at different times. The female incubates the eggs and broods the young, and the male provides food for her and when they hatch, for the nestlings as well. Continuing parental care for the young is provided by both adults for about five months.

There are about a dozen subspecies of Eurasian eagle-owl. With a total range in Europe and Asia of about 32 million square kilometres (12 million square miles) and a total population estimated to be between 250 thousand and 2.5 million individuals, the IUCN lists the bird's conservation status as being of "least concern".

Description[edit]

At Carolina Raptor Center, North Carolina
The wings have a wide spread.
The great size, barrel-shaped build and conspicuous ear tufts make this a distinctive owl.

The Eurasian eagle-owl is a very large bird, smaller than the golden eagle (Aquila chrysaetos) but larger than the snowy owl. It is sometimes referred to as the world's largest owl, although Blakiston's fish owl (B. blakistoni) is slightly heavier on average and the great grey owl (Strix nebulosa) is slightly longer on average.[4] The Eurasian eagle-owl has a wingspan of 160–188 cm (63–74 in), with the largest specimens attaining 200 cm (79 in). The total length of the species can range from 56 to 75 cm (22 to 30 in). Females weigh 1.75–4.2 kg (3.9–9.3 lb) and males weigh 1.5–3 kg (3.3–6.6 lb).[3][5][6][7][8] In comparison, the barn owl (Tyto alba), the world's most widely distributed owl species, weighs about 500 grams (1.1 lbs) and the great horned owl (B. virginianus), which fills the Eurasian eagle-owl's ecological niche in North America, weighs around 1.4 kg (3.1 lbs).[9] Among standard measurements, the tail measures 23–31 cm (9.1–12.2 in) long, the tarsus measures 7.4–8.8 cm (2.9–3.5 in) and the bill is 4.2–5.8 cm (1.7–2.3 in).[7][10]

Based on the wing chord length (the only measurement taken for many of the less studied subspecies), there is considerable variation across the races, with owls at higher altitudes and more Northern latitudes being the larger varieties. The smallest race is B. b. nikolskii, found in warm, rocky desert-like habitats from eastern Iraq and Iran to Pakistan and Afghanistan and measuring 37.8–46 cm (14.9–18.1 in) in wing chord length. The largest race is B. b. yenisseenis of the icy forests of central Siberia to northern Mongolia at 44.3–51.8 cm (17.4–20.4 in).[7][10] Many subspecies still require detailed description and study.[11]

The great size, barrel-shaped build and conspicuous ear tufts make this a distinctive owl. In the nominate subspecies, the upper parts are mottled brownish-black and tawny-buff while the wings and tail are barred in similar shades. The facial disc is poorly developed, cream above and tawny-buff below, and incomplete above the eyes, which have orange irises. The beak and the feet are black. The crown of the head is brownish-black, each feather having a buff or cream-coloured edge. The long feathers making up the ear tufts extend about 60 mm (2.4 in) above the rest of the plumage on either side of the crown. The feathers on the back of the neck, the scapulars and the mantle are brownish-black with tawny edges. The back, rump and upper tail coverts are tawny-buff with wavy bars and streaks, and the tail feathers are dark brown with cream, buff and tawny-brown irregular lines.[12]

The chin and throat are white with a brownish central streak. The feathers of the upper breast have brownish-black centres and reddish-brown edges except for the central ones which have white edges. The lower breast and belly feathers are cream to tawny buff with dark barring. The underwing coverts and undertail coverts are similar but more strongly barred in brownish-black. The primaries and secondaries are brown with broad dark brown bars and dark brown tips, and grey or buff irregular lines. A complete moult takes place each year between July and December.[12]

Habitat[edit]

Eurasian eagle-owls are distributed sparsely through rocky areas but can potentially inhabit a wide range of habitats. They have been found in habitats as diverse as Northern coniferous forests and the edge of vast deserts. They are often found in the largest numbers in areas where cliffs and ravines are surrounded by a scattering of trees and bushes. Taiga, rocky coast lines, steppe and grasslands, may also be visited, largely while hunting. Their territories cover on average about 42.5 square kilometres (16.4 sq mi).[7][13] Due to their preference for rocky habitats, the species is often found in mountainous areas and can be found at elevations of up to 2,000 m (6,600 ft) in Europe and 4,500 m (14,800 ft) in Asia. However, they can also be found at sea level,[10] on islands and even over extensive reed beds. The birds roost by day in rock clefts, ruins, large hollow trees and dense foliage.[12]

Although found in the largest numbers in areas sparsely populated by humans, farmland is include in their habitat types and they have even been observed living in park-like settings within European cities.[7] Since 2005, at least five couples have nested in Helsinki. This is due in part to feral European rabbits (Oryctolagus cuniculus) having recently populated the Helsinki area, originally from pet rabbits released to the wild.[14] In June 2007, a Eurasian eagle-owl nicknamed 'Bubi' landed in the crowded Helsinki Olympic Stadium during the European Football Championship qualification match between Finland and Belgium and interrupted the match for six minutes.[15] Finland's national football team have had the nickname Huuhkajat (Finnish for Eurasian eagle-owls) ever since. The owl was named "Helsinki Citizen of the Year" in December 2007.[16]

Behaviour[edit]

Threat posture

The Eurasian eagle-owl is largely nocturnal in activity, as are most owl species. It has a number of vocalizations that are used at different times. The song, which can be heard at great distance, is a deep resonant ooh-hu with emphasis on the first syllable for the male, and a more high-pitched uh-hu for the female. These calls are repeated at intervals of up to a minute. Other calls include a rather faint OO-OO-oo and a harsh kveck-kveck. Annoyance at close quarters is expressed by bill-clicking and cat-like spitting, and a defensive posture involves lowering the head, ruffling the back feathers, fanning the tail and spreading the wings.[12] When perching it adopt an upright stance with plumage closely compressed and may stand tightly beside a tree trunk in a similar fashion to a long-eared owl.[12]

This broad-winged species has a strong direct flight, usually consisting of shallow wing beats and long, fast glides. It has, unusually for an owl, also been known to soar on updrafts on a few occasions. The latter method of flight has led them to be mistaken for Buteos, which are smaller and quite differently proportioned.[13]

The Eurasian eagle-owl can live for up to twenty years in the wild. However, like many other bird species in captivity they can live much longer without having to endure difficult natural conditions, and have possibly survived up to 60 years in zoo collections. Healthy adults normally have no natural predators and are thus considered apex predators, although they can be mobbed by a variety of smaller birds, including smaller hawks and owls. The leading causes of death for this species are man-made: electrocution, traffic accidents and shooting sometimes kill or injure it.[5][7]

Feeding[edit]

With pine marten prey in Czech Republic

This eagle-owl mainly feeds on small mammals in the 200–2,000 g (0.44–4.41 lb)[6] weight range, such as voles, rats, mice, rabbits and hares. However, prey can be killed up to the size of both fully-grown foxes and marmots and young deer (up to a mass of 17 kg (37 lb)), if taken by surprise.[17] In central Europe, hedgehogs are often a favorite prey item, being eaten after the owl skins off their prickly backs.[7] Eurasian eagle-owls may habitually visit refuse dumps to feed on rats. The other significant group of prey for Eurasian eagle-owls is other birds and almost any type of bird may fall victim. Common avian prey includes corvids, grouse, woodpeckers, herons and, especially near coastal areas, ducks, seabirds and geese.[5] Other raptors, including large species such as northern goshawks (Accipiter gentilis), peregrine falcons (Falco peregrinus) and the largest buzzards, are regularly attacked as also are almost any other species of owl encountered.[8] When there is an opportunity, they will also prey on reptiles, including large and venomous snakes, frogs, fish and even large insects and earthworms.[7]

The hunting method usually used by this owl is to watch from a perch for animal movement and then to swoop down swiftly once prey has been spotted. The prey is often killed quickly by the Eurasian eagle-owl's powerful talons though alternatively it may be bitten on the head. Then the victim is carried off to be swallowed whole or torn into pieces with the bill. Occasionally, this owl may capture other birds on the wing, including nocturnal migrants which are intercepted in mid-flight. Larger prey (over 3.5 kg (7.7 lb)) is consumed on the ground which leaves the owl vulnerable to loss of their prey or even attack by predators such as foxes. The dietary preferences of the species frequently overlap with the larger golden eagle but direct competition is uncommon due to differing times of activity between the species.[7]

Breeding[edit]

Footage of an adult tending to a nest with juveniles

Courtship in the Eurasian eagle-owl may involve bouts of "duetting", with the male sitting upright and the female bowing as she calls. There may be mutual bowing, billing and fondling before the female flies to a perch where coitus occurs, usually taking place several times over the course of a few minutes. This owl usually nests on a cliff ledge, in a crevice, a gully or cave, but sometimes nests on the ground, between rocks or in some other concealed location. It often uses the same nest site year after year.[12] Occasionally, it may take over a nest made by a large bird such as a common raven (Corvus corax) or golden eagle. Laying generally begins in late winter but may be later in the year in colder habitats. A single clutch of up to six white eggs is laid, each egg measuring 56–73mm x 44.2–53mm (2.2–2.9" x 1.7–2.1") and weighing 75–80 g (2.6–2.8 oz). The eggs are normally laid at intervals of three days and are incubated only by the female. The first egg hatches after 31 to 36 days. During the incubation period, the female is brought food at the nest by her mate.[5]

The female continues to brood the young which are of different ages as a result of the eggs hatching successively. The male continues to bring prey and the female feeds the nestlings, tearing up the food into suitably-sized pieces. The chicks grow rapidly, being able to consume small prey whole after a few weeks. The female resumes hunting after about three weeks which increases the food supply to the chicks. These can walk around at five weeks and by seven weeks are taking short flights. Both parents continue to care for them for about five months, and in Europe the young disperse or are driven from their parents' territory in the autumn. They reach sexual maturity by the following year, but do not normally breed until they can establish a territory at around two or three years old.[5]

Moulting[edit]

Feathers are lightweight and robust but nevertheless need to be replaced periodically as they become worn. In the Eurasian eagle-owl this happens in stages and the first moult starts the year after hatching with some body feathers and wing coverts being replaced. The next year the three central secondaries on each wing and three middle tail feathers are shed and regrow, and the following year two or three primaries and their coverts are lost. In the final year of this post-juvenile moult, the remaining primaries are moulted and all the juvenile feathers will have been replaced. Another moult takes place during years six to twelve of the bird's life. This happens between June and October after the conclusion of the breeding season and again it is a staged process with six to nine main flight feathers being replaced each year. Such a moulting pattern lasting several years is repeated throughout the bird's life.[18]

Taxonomy[edit]

B. b. sibiricus
B. b. omissus at Tierpark Berlin, Germany

The Eurasian eagle-owl was first described by the Swedish naturalist Carl Linnaeus in his 10th edition of Systema Naturae in 1758.[2] It is a member of the horned owl genus Bubo which includes the eagle-owls, the horned owls, the fish owls and the snowy owl.[19] About a dozen subspecies are recognised,[2] but the exact number is unclear and they tend to intergrade where their ranges overlap. Two owls formerly considered subspecies of the Eurasian eagle-owl are now recognized as distinct species: the pharaoh eagle-owl (B. ascalaphus) and the rock eagle owl (B. bengalensis).[11]

  • B. b. bubo – Scandinavia and Spain through western Europe to western Russia.[2]
  • B. b. hispanus – Iberian Peninsula; formerly Atlas Mountains. Possibly extinct.[2]
  • B. b. ruthenus – Central European Russia to Ural Mountains and lower Volga basin.[2]
  • B. b. interpositus – Turkey and northwestern Iran to southern Ukraine, Romania and Bulgaria.[2]
  • B. b. sibiricus – Western Ural Mountains to Ob River and western Altai.[2]
  • B. b. yenisseensis – Central Siberia to northern Mongolia.[2]
  • B. b. jakutensis – Northeastern Siberia, from Lena River to Sea of Okhotsk.[2]
  • B. b. ussuriensis – Southeastern Siberia to northeastern China, Sakhalin Island, northern Hokkaido and southern Kuril Islands.[2]
  • B. b. turcomanus or B. b. omissus – Lower Volga River and Ural River to northwestern China and western Mongolia.[2]
  • B. b. nikolskii – Eastern Iraq to Iran, Afghanistan and western Pakistan.[2]
  • B. b. hemachalana – Pamirs and northern Tien Shan southwards to western Himalayas and western Tibet.[2]
  • B. b. kiautschensis – Western and central China (southwards to Yunnan and Sichuan) to Korea and southeastern China.[2]

Status[edit]

The Eurasian eagle-owl has a very wide range across much of Europe and Asia, estimated to be about 32,000,000 square kilometres (12,000,000 sq mi). In Europe there are estimated to be between 19,000 and 38,000 breeding pairs and in the whole world around 250,000 to 2,500,000 individual birds. The population trend is thought to be decreasing because of human persecution, but with such a large range and large total population, the International Union for Conservation of Nature has rated the bird as being of "least concern".[20]

The species used to be present in Great Britain but died out, probably by about 9,000 years ago after the last ice age. The flooding of the land bridge between Britain and continental Europe may have been responsible for their extirpation as they only disperse over limited distances. Some breeding pairs do still occur in Britain however, but they are believed to be individuals that have escaped from captivity.[21]

References[edit]

  1. ^ BirdLife International (2012). "Bubo bubo". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2014-07-31. 
  2. ^ a b c d e f g h i j k l m n o "Eurasian Eagle-Owl (Bubo bubo) (Linnaeus, 1758)". AviBase. Retrieved 2014-07-25. 
  3. ^ a b Ali, S. (1993). The Book of Indian Birds. Bombay: Bombay Natural History Society. ISBN 978-0-19-563731-1. 
  4. ^ "Owl Frequently Asked Questions". Owlpages.com. Retrieved 2014-07-31. 
  5. ^ a b c d e "Eurasian Eagle Owl - Bubo bubo - Information, Pictures, Sounds". Owlpages.com. 2005-04-21. Retrieved 2014-07-31. 
  6. ^ a b Schuchmann (1999). Eurasian Eagle Owl (Bubo bubo). pp. 186 in: del Hoyo, Elliott & Sargatal, eds (1999). Handbook of the Birds of the World. Vol. 5. Lynx Edicions ISBN 84-87334-25-3
  7. ^ a b c d e f g h i König, Claus; Weick, Friedhelm; Becking, Jan-Hendrik (2009). Owls of the World. AC Black. pp. 122–126, 323–325, 335. ISBN 978-1-4081-0884-0. 
  8. ^ a b Animal Records Carwadine, Mark. Sterling (2008), ISBN 1-4027-5623-2
  9. ^ CRC Handbook of Avian Body Masses Dunning John B. Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  10. ^ a b c Weick, Friedhelm (2007). Owls (Strigiformes): Annotated and Illustrated Checklist. Springer. pp. 104–107. ISBN 978-3-540-39567-6. 
  11. ^ a b Sibley, Charles Gald; Monroe, Burt Leavelle (1990). Distribution and Taxonomy of Birds of the World. Yale University Press. ISBN 9780300049695. 
  12. ^ a b c d e f Witherby, H. F. (ed.) (1943). Handbook of British Birds, Volume 2: Warblers to Owls. H. F. and G. Witherby Ltd. pp. 312–315. 
  13. ^ a b "Eurasian Eagle-Owl". Peregrinefund.org. Retrieved 2011-12-01. 
  14. ^ "At least five eagle owls live in Helsinki", Helsingin Sanomat - International Edition
  15. ^ "Bubi the eagle owl has not returned to the Olympic Stadium", Helsingin Sanomat - International Edition
  16. ^ (Finnish) Palkittu Bubi käväisi yllättäen palkitsemistilaisuudessa - HS.fi - Kaupunki
  17. ^ Andrews, Peter (1990) Owls, Caves, and Fossils: Predation, Preservation, and Accumulation of Small Mammal Bones in Caves, with an Analysis of the Pleistocene Cave Faunas from Westbury-sub-Mendip, Somerset, UK University of Chicago Press. 231pages. ISBN ,
  18. ^ Blasco-Zumeta, Javier; Heinze, Gerd-Michael. "Eagle owl". Laboratorio Virtual Ibercaja. Retrieved 2014-09-16. 
  19. ^ "Genus: Bubo". Owls of the World. World Owl Trust. 2005. Retrieved 2014-09-16. 
  20. ^ "Species factsheet: Bubo bubo". Birdlife International. Lynx Edicions. 2014. Retrieved 2014-07-26. 
  21. ^ "Eagle owls in Britain". RSPB. Retrieved 1 October 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!