Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Overview

Distribution

Geographic Range

Eagle owls primarily live in the Palearctic region, although they can travel as far south as the Oriental Region and Ethiopian Region and as far north as the far reaches of Siberia. They are found in North Africa, Europe, The Middle East, and Asia.

Biogeographic Regions: palearctic ; oriental ; ethiopian

Other Geographic Terms: holarctic ; cosmopolitan

  • Konig, C., J. Becking, F. Weick. 1999. Owls: A Guide to the Owls of the World. New York, NY: Yale University Press.
  • Parry-Jones, J. 1998. Understanding Owls: Biology, Management, Breeding, Training. New York, NY: David and Charles.
  • The Peregrine Fund. 2003. "Eurasian Eagle Owl" (On-line). The Peregrine Fund. Accessed March 21, 2003 at http://www.peregrinefund.org/Explore_Raptors/owls/eagleowl.html.
  • Centre for the Conservation of Specialized Species. 2002. "The Eurasian Eagle Owl" (On-line ). The Centre for the Conservation of Specialized Species. Accessed 3/21/03 at http://www.conservationcentre.org/scase21.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Eagle owls are the largest owls in the world, and they are best known for their large, striking, orange eyes. They are often called the Old World version of America's widely distributed great horned owl. They have prominent ear tufts and are primarily brown-black and tawny-buff in color. Their facial disk is heavily marked with black, gray, and white. Their upper parts are darker than their lower parts, which have black streaks, and their throat is white. It is interesting to note that these owls become paler in the northeastern geographic regions and get progressively darker as you move to the Pacific coast. Also, size tends to decrease from north to south, and east to west.

Range mass: 1600 to 4200 g.

Average mass: 2800 g.

Range length: 58 to 71 cm.

Average length: 65 cm.

Range wingspan: 1.5 to 2 m.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: female larger

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These owls can be found in many different kinds of habitats including wooded areas (coniferous forests), warm deserts, mountain ranges, and riverbeds. They prefer to live in rocky landscapes, especially when nesting. Eagle owls search for habitats with adequate food supply and proper nesting sites. Their habitats vary greatly, and they can also be found in open areas that have few trees like farmlands and grasslands.

Habitat Regions: temperate ; polar ; terrestrial

Terrestrial Biomes: tundra ; taiga ; desert or dune ; savanna or grassland ; forest ; scrub forest ; mountains

Wetlands: marsh ; swamp

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Eagle owls are carnivores. They are primarily nocturnal hunters and have various hunting techniques. They take their prey in flight or on the ground. They prefer to hunt in open spacious locations rather than forests. Most owls are very capable hunters and the eagle owl is no exception. Owl wings have evolved to make very little noise when flapping. With their night vision, advanced hearing, and silent flight they are the hit men of their territory. Their prey usually has no idea they were being stalked. They feed on almost anything they can catch including rats, mice, voles, beetles and even large prey like deer fawns and foxes. They will also feed on other birds such as crows, ducks, and even other owls. Dominant prey can vary from habitat to habitat but is most often small rodents.

Animal Foods: birds; mammals; reptiles; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Eagle owls are at the top of their food chain. They are particularly useful in keeping the number of rodents down in their various ecosystems. The removal of this species can cause the rodent population in a given area to grow significantly. Therefore, they may be a keystone predator.

Ecosystem Impact: keystone species

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Once eagle owls reach adulthood, they are at a very low risk of predation. They are at the top of the food chain in their niche. They are not a major food source for any other species. The only time they are at risk of predation is during their early years. They are at risk from any predator too large for them too eat. Fortunately, the mother stays with the young for most of this period and keeps the predators at bay. Due to their striped, spotted, and varied coloring, they are extremely well camouflaged, especially when perching in the trees.

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Bubo bubo preys on:
Tyto alba
Dryomys nitedula

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Eagle owls are known for their loud calls. They are heard far more than they are seen. They use their various hoots and clucks to let others know they have entered or are entering certain territories. Different hoots represent different moods and are easily recognizable between each member of the species. Also, eagle owls are able to decipher the size and distance of intruders based on the intensity of their call. They also use a low gutteral hoot to attract mates. It's interesting to note that even though eagle owls are difficult to study, they (like other owls) cough up what is known as an owl pellet after their stomach goes through the digestive process. These owl pellets contain the hair, feathers, and bones of prey they were unable to digest. These pellets are very useful to scientists because they help them understand the food habits of these elusive birds.

Communication Channels: visual ; acoustic

Perception Channels: vibrations

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Eagle owls have relatively long life spans once they reach adulthood. They have no real natural enemies. In the wild, they live for approximately 20 years, but they can live more than 60 years in captivity.

Range lifespan

Status: wild:
68 (high) years.

Range lifespan

Status: captivity:
64 (high) years.

Typical lifespan

Status: wild:
10 to 20 years.

Typical lifespan

Status: captivity:
20 to 60 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 68 years (captivity) Observations: In captivity these animals may live over 60 years.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Both sexes are usually solitary but they pair up during courtship. They advertise potential breeding sites by digging a shallow depression into the earth and emitting a light staccato note and various clucking sounds. They also use these calls to keep track of their mate's location. People often hear them calling to each other. They keep the same partners for life. Eagle owls are very sensitive to their environment. If there is not enough food resources, will mate at a much slower rate and later into the year. When they have sufficient habitats and plentiful food, their mating rate increases significantly.

Mating System: monogamous

Eagle owls form pairs in early fall and nest in late January and early February. They prefer to nest in crevices between rocks, sheltered cliff ledges, cave entrances, as well as abandoned nests of other large birds. Usually egg laying begins in late winter. They usually have one batch of eggs per year ranging from one to four white eggs. This number depends on the food availiable in their area. When the owlets hatch, they are brooded for about two weeks. In about three weeks the young begin to feed and swallow by themselves. By week five they can walk around the nesting area and begin to fly about 60 days, although for only a few meters. They leave the nest or are driven out in the fall (Sept-Nov.) Eagle owls are able to breed from the ages of 2-31 years.

Breeding interval: Breeding occurs once a year.

Breeding season: The breeding season lasts from December to April.

Range eggs per season: 1 to 4.

Average eggs per season: 3.

Range time to hatching: 2 to 3 months.

Range fledging age: 20 to 24 weeks.

Range time to independence: 9 to 12 months.

Range age at sexual or reproductive maturity (female): 1 to 3 years.

Range age at sexual or reproductive maturity (male): 1 to 3 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Once the eggs are laid, they are incubated by the female alone. The male kills prey and feeds his mate. Once the eggs hatch, the male continues to bring food to the female for the next two weeks. During this time the female stays at the nest protecting her young from predators and teaching them how to eat on their own. All owls are imprinted by their mothers, which means they will imitate the first animal they see. This makes it difficult to release owls into captivity if they are not raised by an owl parent. If an owl sees a human when they are born, they think they are human too.

Parental Investment: male parental care ; female parental care

  • Konig, C., J. Becking, F. Weick. 1999. Owls: A Guide to the Owls of the World. New York, NY: Yale University Press.
  • Parry-Jones, J. 1998. Understanding Owls: Biology, Management, Breeding, Training. New York, NY: David and Charles.
  • Penteriani, V., M. Gallardo, P. Roche. 2002. Landscape structure and food supply affect eagle owl (Bubo bubo) density and breeding performance: a case of intra-population heterogeneity. Journal of Zoology, 257: 365-372.
  • The Peregrine Fund. 2003. "Eurasian Eagle Owl" (On-line). The Peregrine Fund. Accessed March 21, 2003 at http://www.peregrinefund.org/Explore_Raptors/owls/eagleowl.html.
  • Centre for the Conservation of Specialized Species. 2002. "The Eurasian Eagle Owl" (On-line ). The Centre for the Conservation of Specialized Species. Accessed 3/21/03 at http://www.conservationcentre.org/scase21.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Bubo bubo

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCCAACCACAAAGACATTGGCACCCTCTACCTAATCTTCGGGGCATGAGCAGGCATAGTTGGCACTGCCCTCAGCCTACTTATCCGAGCCGAACTCGGCCAACCCGGGACCCTTCTTGGCGACGACCAAATCTACAACGTAGTTGTCACCGCCCATGCCTTTGTAATAATCTTTTTTATGGTCATACCCATCATGATCGGAGGATTTGGAAACTGATTAGTCCCACTAATAATTGGAGCCCCAGACATAGCCTTCCCCCGCATAAACAACATAAGCTTCTGACTACTCCCACCCTCACTCCTACTCCTACTAGCCTCCTCCACTGTAGAAGCCGGAGCGGGCACCGGATGAACCGTCTACCCCCCATTAGCTGGCAACCTAGCCCATGCCGGCGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACTTGGCTGGAGTATCATCCATCCTAGGGGCAATTAACTTCATCACCACTGCCATTAACATAAAACCCCCGGCGCTCTCACAATACCAAACCCCCCTATTTGTATGATCTGTCCTCATCACCGCCATTCTCCTCCTACTATCCCTCCCAGTTCTCGCCGCCGGCATTACCATACTACTAACCGACCGCAACTTAAACACCACATTCTTCGACCCCGCCGGAGGGGGCGACCCAATCCTATATCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTCTACATCCTAATCCTCCCAGGATTTGGAATTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Bubo bubo

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 9
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Eagle owls are considered rare but not yet threatened. Their numbers are steadily declining due to habitat loss from human encroachment.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii; appendix iii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 19000-38000 breeding pairs, equating to 57000-114000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 250000-2500000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse affects of the eagle owl on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Eagle owls are economically beneficial to farmers that want to keep the number of rodents down on their land. Many birdwatchers will also pay to get a glimpse of this rare bird in its natural habitat as well as in zoos.

Positive Impacts: ecotourism ; research and education; controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Eurasian Eagle-Owl

The Eurasian Eagle-Owl (Bubo bubo) is a species of eagle owl resident in much of Eurasia. It is sometimes called the European Eagle-Owl and is, in Europe where it is the only member of its genus besides the Snowy Owl (B. scandiacus), occasionally abbreviated to just Eagle-Owl. In India, it is often called the Indian Great Horned Owl, though this may cause confusion with the similarly-named American bird.[2] It is one of the largest species of owls.

Contents

Description [edit]

The Eagle Owl is a very large and powerful bird, smaller than the Golden Eagle (Aquila chrysaetos) but larger than the Snowy Owl. It is sometimes referred to as the world's largest owl, although Blakiston's Fish Owl (B. blakistoni) is slightly heavier on average and the Great Grey Owl (Strix nebulosa) is slightly longer on average.[3][4] The Eagle Owl has a wingspan of 160–188 cm (63–74 in), with the largest specimens attaining 200 cm (79 in). The total length of the species can range from 56 to 75 cm (22 to 30 in). Females weigh 1.75–4.2 kg (3.9–9.3 lb) and males weigh 1.5–3 kg (3.3–6.6 lb).[2][5][6][7][8] In comparison, the Barn Owl (Tyto alba), the world's most widely-distributed owl species, weighs about 500 grams (1.1 lbs) and the Great Horned Owl (B. virginianus), which fills the Eagle Owl's ecological niche in North America, weighs around 1.4 kg (3.1 lbs).[9] Among standard measurements, the tail measures 23–31 cm (9.1–12 in) long, the tarsus measures 7.4–8.8 cm (2.9–3.5 in) and the bill is 4.2–5.8 cm (1.7–2.3 in).[7][10]

Based on the wing chord length (the only measurement taken for the many of the less studied subspecies), there is considerable variation across the races, with owls at higher altitudes and more Northern latitudes being the larger varieties. The smallest race is B. b. nikolskii, found in warm, rocky desert-like habitats from eastern Iraq and Iran to Pakistan and Afghanistan and measuring 37.8–46 cm (14.9–18 in) in wing chord length. The largest race is B. b. yenisseenis of the icy forests of central Siberia to northern Mongolia at 44.3–51.8 cm (17.4–20.4 in).[7][10] Many subspecies still require detailed description and study. Two owls formerly considered subspecies of the Eurasian Eagle Owl are now recognized as distinct species: the Pharaoh Eagle-Owl (B. ascalaphus) and the Rock Eagle Owl (B. bengalensis).

The great size, bulky, barrel-shaped build, ear tufts and orange eyes make this a distinctive species. The ear tufts of males are more upright than those of females. The plumage coloration, across 13 accepted subspecies, however can be somewhat variable. The upperparts may brown-black to tawny-buff to pale creamy gray, typically showing as dense freckling on the forehead and crown, stripes on the nape, sides and back of the neck, and dark splotches on the pale ground colour of the back, mantle and scapulars. A narrow buff band, freckled with brown or buff, often runs up from the base of the bill, above the inner part of the eye and along the inner edge of the black-brown ear tufts. The rump and upper tail-coverts are delicately patterned with dark vermiculations and fine wavy barring. The facial disc is tawny-buff, speckled with black-brown, so densely on the outer edge of the disc as to form a "frame" around the face. The chin and throat are white continuing down the center of the upper breast. The whole of the underparts except for chin, throat and centre of upper breast is covered with fine dark wavy barring, on a tawny-buff ground colour. Legs and feet (which are feathered almost to the talons) are likewise marked on a buff ground colour but more faintly. The tail is tawny-buff, mottled dark grey-brown with about six black-brown bars. The bill and feet are black, the iris is orange (yellow in some subspecies).[7]

Habitat [edit]

Eagle Owls are distributed sparsely through rocky areas but can potentially inhabit a wide range of habitats. They have been found in habitats as diverse as Northern coniferous forests and the edge of vast deserts. They are often found in the largest numbers in areas where cliffs and ravines are surrounded by a scattering of trees and bushes. Taiga, rocky coast lines, steppe and grasslands, may also be visited, largely while hunting in their large territories.[7][11] Due to their preference for rocky areas, the species is often found in mountainous areas and can be found up to elevations of 2,000 m (6,600 ft) in Europe and 4,500 m (14,800 ft) in Asia. However, they can also be found at sea level.[10]

Although found in the largest numbers in areas sparsely populated by humans, farmland is sometimes inhabited and they even have been observed living in park-like settings within European cities.[7] Since 2005, at least five couples have nested in Helsinki.[12] This is due in part to feral European rabbits (Oryctolagus cuniculus) having recently populated the Helsinki area, originally from pet rabbits released to the wild. The number is expected to increase due to the growth of the European rabbit population in Helsinki. European Hares (Lepus europaeus), the often preferred prey species of the Eagle-owls in their natural habitat, live only in rural areas of Finland, not in the city centre. In June 2007, an Eagle Owl nicknamed 'Bubi' landed in the crowded Helsinki Olympic Stadium during the European Football Championship qualification match between Finland and Belgium. The match was interrupted for six minutes.[13] After tiring of the match, following Jonathan Johansson's opening goal for Finland, the bird left the scene.[13] Finland's national football team have had the nickname Huuhkajat (Finnish for Eurasian Eagle-Owls) ever since. The owl was named "Helsinki Citizen of the Year" in December 2007.[14]

Behaviour [edit]

The Eurasian Eagle Owl is largely nocturnal in activity, as are most owl species. The call of the Eagle Owl is a deep resonant ooh-hu with emphasis on the first syllable for the male, and a more high-pitched uh-Hu for the female. Each member of an Eagle Owl population can be identified by means of its vocalizations.

This broad-winged species has a strong direct flight, usually consisting of shallow wing beats and long, fast glides. It has, unusually for an owl, also been known to soar on updrafts on a few occasions. The latter method of flight has led them to be mistaken for Buteos, which are smaller and quite differently-proportioned.[11]

Eurasian Eagle Owl - Threat posture

Feeding [edit]

This eagle owl mainly feeds on small mammals in the 200–2,000 g (0.44–4.4 lb)[6] weight range, such as voles, rats, mice, rabbits and hares. However, prey can be killed up to the size of both fully-grown foxes and marmots and young deer (up to a mass of 17 kg (37 lb)), if taken by surprise.[15] In central Europe, hedgehogs are often a favorite prey item, being eaten after the owl skins off their prickily backs.[7] Eagle owls may habitually visit refuse dumps to predate rats. The other significant group of prey for Eurasian Eagle Owls is other birds and almost any type of bird is potential prey. Common avian prey includes corvids, grouse, woodpeckers, herons and, especially near coastal areas, ducks, seabirds and geese.[16] Other raptors, including large species such as Northern Goshawks (Accipiter gentilis), Peregrine Falcons (Falco peregrinus) and the largest buzzards, are regularly predated as well as almost any other type of owl encountered.[8] When there is an opportunity, they will also prey on reptiles, including large and venomous snakes, frogs, fish and even large insects and earthworms.[7]

Hunting usually consist of the owl watching from a perch for prey activity and then swooping down swiftly once prey is spotted. The prey is often killed quickly by the eagle owl's powerful talons though is sometimes bitten on the head to be killed as well. Then the prey item is carried off to be swallowed whole or torn into pieces with the bill. Occasionally, they may capture other birds on the wing, including nocturnal migrants which are intercepted in mid-flight. Larger prey (over 3.5 kg (7.7 lb)) is consumed on the ground which leaves the owl vulnerable to loss of their prey or even predation by predators such as foxes. The dietary preferences of the species frequently overlap with the larger Golden Eagle but direct competition is uncommon due to differing times of activity between the species.[7]

Breeding [edit]

Close-up of the head
Eurasian Eagle-Owl in the British Wildlife Centre in Newchapel, Surrey

This species usually nests on cliff ledges, crevices and caves. Occasionally, they may also take over a bird nest made by a large bird such as common raven (Corvus corax) or golden eagle. Laying generally begins in late winter, sometimes later. One clutch per year of 1-6 white eggs are laid, measuring 56-73mm x 44.2- 53mm (2.2- 2.9" x 1.7- 2.1") and weighing 75- 80 g (2.6- 2.8 oz). They are normally laid at 3 days intervals and are incubated by the female alone, starting from the first egg, for 31–36 days. During this time, she is fed at the nest by her mate.

Once hatched, the young open their eyes at around 2 days old and are brooded for about 2 weeks. The female stays with her offspring at the nest for 4–5 weeks. For the first 2–3 weeks the male brings food to the nest or deposits it nearby, and the female feeds small pieces the young, or the male feeds the young directly. At 3 weeks the chicks start to feed themselves and begin to swallow smaller items whole. At 5 weeks the young walk around the nesting area, and at 52 days are able to fly a few metres. They may leave ground nests as early as 22–25 days old, while elevated nests are left at an age of 5–7 weeks. Fledged young are cared for by both parents for around 20–24 weeks. They become independent between September and November in Europe, and leave the parents' territory (or are driven out by them). At this time the male begins to sing again and inspect potential future nesting sites. The young technically reach sexual maturity by the following year, but do not normally breed until they can establish a territory at around 2–3 years old.[7]

In winter

The Eagle Owl can live for up to 20 years in the wild. However, like many other bird species in captivity they can live much longer without having to endure difficult natural conditions, and have possibly survived up to 60 years in zoo collections. Healthy adults normally have no natural predators and are thus considered apex predators. The leading causes of death for this species are man-made: electrocution, traffic accidents and shooting sometimes claim the eagle owl.[5][7]

Subspecies [edit]

  • B. b. bubo
  • B. b. hispanus
  • B. b. ruthenus
  • B. b. interpositus
  • B. b. sibericus
  • B. b. yenisseensis
  • B. b. jakutensis
  • B. b. ussuriensis
  • B. b. turcomanus
  • B. b. omissus
  • B. b. nikolskii
  • B. b. hemachalana
  • B. b. kiautschensis
  • B. b. swinhoei

References [edit]

  1. ^ BirdLife International (2012). "Bubo bubo". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ a b Ali, S. (1993). The Book of Indian Birds. Bombay: Bombay Natural History Society. ISBN 0-149-563731-3 Check |isbn= value (help). 
  3. ^ "Owl Frequently Asked Questions". Owlpages.com. Retrieved 2010-03-19. 
  4. ^ [1][dead link]
  5. ^ a b "Eurasian Eagle Owl - Bubo bubo - Information, Pictures, Sounds". Owlpages.com. 2005-04-21. Retrieved 2011-12-01. 
  6. ^ a b Schuchmann (1999). Eurasian Eagle Owl (Bubo bubo). pp. 186 in: del Hoyo, Elliott & Sargatal, eds (1999). Handbook of the Birds of the World. Vol. 5. Lynx Edicions, Barcelona. ISBN 84-87334-25-3
  7. ^ a b c d e f g h i j k Owls of the World by Konig, Weick & Becking. Yale University Press (2009), ISBN 0300142277
  8. ^ a b Animal Records by Mark Carwadine. Sterling (2008), ISBN 1402756232
  9. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  10. ^ a b c Annotated And Illustrated Checklist
  11. ^ a b "Eurasian Eagle-Owl". Peregrinefund.org. Retrieved 2011-12-01. 
  12. ^ "At least five eagle owls live in Helsinki", Helsingin Sanomat - International Edition
  13. ^ a b "Bubi the eagle owl has not returned to the Olympic Stadium", Helsingin Sanomat - International Edition
  14. ^ (Finnish) Palkittu Bubi käväisi yllättäen palkitsemistilaisuudessa - HS.fi - Kaupunki
  15. ^ Andrews, Peter (1990) Owls, Caves, and Fossils: Predation, Preservation, and Accumulation of Small Mammal Bones in Caves, with an Analysis of the Pleistocene Cave Faunas from Westbury-sub-Mendip, Somerset, UK University of Chicago Press. 231pages. ISBN ,
  16. ^ [2] (2011).
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!