Articles on this page are available in 1 other language: Spanish (17) (learn more)

Overview

Distribution

Great potoos are neotropical birds found throughout Central America from as far north as southern Mexico to as far south as Bolivia.

Biogeographic Regions: neotropical (Native )

  • Grzmek, B. 2002. Grzmek's Animal Life Encyclopedia. Pp. 395-400 in M Hutchins, J Jackson, W Bock, eds. Birds I-IV, Vol. 9, 2 Edition. Farmington Hills, Michigan: Thomson-Gale.
  • Rangel-Salazar, L., H. Vega-Rivera. 1989. Two new records of birds for southern Mexico. The Condor, 91: 214-215.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Extreme s Mexico to n Bolivia, Paraguay and se Brazil.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Great potoos have relatively large heads in relation to their bodies. They have large eyes with a light brown to yellow iris and beaks that are short but broad, giving them a very large gape. In comparison to other Caprimulgiformes, the facial bristles are diminished to non-existent. They have elliptical wings with an elongate tail that aides in steering during noiseless landings on tree branches. The plumage is white to grayish with marbled black and burgundy tones. Tail coloration matches that of the body, with the exception of the 8 or 9 white bars that extend laterally across it.

Range mass: 360 to 650 g.

Range length: 480 to 600 mm.

Range wingspan: 700 to 804 mm.

Average wingspan: 734.8 mm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry ; polymorphic

Sexual Dimorphism: sexes alike

  • Borerro, J. 1974. Notes on the structure of upper eyelid of potoos.. The Condor, 76: 210-211.
  • Land, H., W. Schultz. 1963. A proposed subspecies of the Great Potoo, Nyctibius grandis. Auk, 80: 195-196.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Great potoos live primarily in forests and rainforests but have also been found in forest edge habitat and on and around farmlands. During they day they are usually found either perched or nesting at least 12 m above ground level in larger trees, usually on branches that are approximately 20 to 30 cm in diameter. At night they may move to lower perches, as low as 1.5 m above the ground, from which they hunt.

Range elevation: 35 to 2900 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest

Other Habitat Features: agricultural

  • Haverschmidt, F. 1948. Observations on Nyctibius grandis in Surinam. Auk, 65: 30-33.
  • Vanderwerf, E. 1988. Observations on the nesting of the great potoo (Nyctibius grandis) in central Venezuela. The Condor, 90: 948-950.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Great potoos are carnivores that hunt nocturnal, flying prey items in the air at night, most frequently large insects and sometimes bats. They usually find a lower perch to fly from and then return to the perch to consume the prey item.

Animal Foods: mammals; insects

Primary Diet: carnivore (Eats terrestrial vertebrates, Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Great potoos are a predatory species that prey on larger flying invertebrates and in some cases vertebrates, like smaller birds or bats.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great potoos are relatively large birds with highly cryptic coloration. During the day great potoos remain relatively motionless, and upon disturbance completely freeze in increase vigilance. The known predators of great potoos include monkeys (Cebus, Ateles geoffroyi, and Alouatta palliata), tayras (Eira barbara), and collared forest falcons (Micrastur semitorquatus). Parents are present at the nest during the day and use their cryptic coloration to camouflage the nesting hole.

Known Predators:

  • capuchin monkeys (Cebus)
  • Central American spider monkeys (Ateles geoffroyi)
  • mantled howler monkeys (Alouatta palliata)
  • tayras (Eira barbara)
  • collared forest falcons (Micrastur semitorquatus)

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Vocalizations in great potoos take place mostly at night and are assumed to be a way of communicating territorial boundaries to other great potoos. The repertoire of vocalizations includes a deeper, frog-like "baaaao" and an eerier "whoap". Between the two different calls the "whoap" occurs more often, and has been heard from both birds that are perched and in flight. In rare instances clicking noises have been heard, but their purpose is unknown.

Communication Channels: acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

  • Slud, P. 1979. Calls of the Geat Potoo. The Condor, 81: 322.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Because of the elusive nature of great potoos, little is known about their longevity and life span. The only documented mortalities were of unknown causes and in one instance a person had shot an adult from a tree.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Great potoos are monogamous breeders with no dimorphism between the sexes. In fact, the sexes are so similar that time budgeting at the nest per sex has not been determined.

Mating System: monogamous

Nesting season in great potoos has been observed from June through August in Venezuela and November in Surinam (these are each the approximate wet seasons for those areas). Only one egg is laid per clutch, and little is known of the incubation period. Great potoos do not build nests, rather nests are simply deeper notches in larger branches of their roosting trees. Hatching in great potoos has not been well documented but only one parent is present at the nest per incubation. Weight at hatching is also questionable with the youngest observed nestling mortality weighing 220g. Time to fledging has been determined to be 55 days after hatching. Chicks develop quickly with body feathers appearing through down feathers approximately two weeks after hatching. Five weeks after hatching chicks are almost 2/3 the length of the parents. Chicks begin leaving the nest and investigating the nesting branch one month after hatching. After a month and a half adults no longer return during the day to tend to young. Instead the only interactions between parent and offspring are after dark, which probably includes feeding behavior. At just under two months offspring have usually left the nest without returning to roost during the day.

Breeding interval: Great potoos produce one egg per year, usually during the rainy season.

Breeding season: Breeding season occurs during the rainy season which varies by region in South America.

Average eggs per season: 1.

Average fledging age: 55 days.

Range time to independence: 1.5 to 2 months.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both male and female great potoos incubate eggs at the nest during the day. During incubation it has been noted that at no point were both parents simultaneously at or around the nest. After the eggs have hatched both parents hunt at night and return to the nest to provision young with prey items. Provisioning continues until offspring have fully fledged and permanently leave the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Haverschmidt, F. 1948. Observations on Nyctibius grandis in Surinam. Auk, 65: 30-33.
  • Vanderwerf, E. 1988. Observations on the nesting of the great potoo (Nyctibius grandis) in central Venezuela. The Condor, 90: 948-950.
  • Young, B., J. Zook. 1999. Nesting of four poorly-known bird species on the Caribbean slope of Costa Rica. The Wilson Bulletin, 111: 124-128.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nyctibius grandis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TCTATACCTAATCTTCGGTGCATGAGCTGGCATAGTGGGTACAGCCCTGAGCTTGCTTATCCGTGCAGAACTTGGTCAACCCGGAACCCTCCTGGGAGATGATCAAATCTACAATGTAATTGTCACCGCCCACGCCTTTGTAATAATTTTCTTTATAGTGATACCAATCATAATTGGCGGATTTGGAAATTGACTCGTCCCACTAATAATTGGTGCCCCGGACATAGCATTCCCCCGCATGAACAATATAAGCTTCTGACTACTTCCCCCATCTTTCCTGCTCTTACTAGCCTCTTCTACGGTAGAAGCTGGAGCTGGCACAGGATGAACTGTATACCCACCACTAGCGGGTAACTTAGCCCATGCTGGAGCCTCAGTGGATCTGGCTATTTTCTCCCTTCATTTGGCAGGTGTATCCTCCATCCTAGGTGCTATCAACTTCATCACAACAGCTATCAACATAAAACCACCCGCCCTCTCCCAATATCAGACTCCCTTATTCGTATGGTCTGTCCTCATTACCGCTGTTCTTCTTCTACTGTCACTACCAGTCCTTGCCGCCGGCATCACCATACTACTTACAGACCGCAACCTGAATACCACATTCTTCGACCCTGCAGGGGGAGGAGACCCTGTCCTATACCAACATCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Nyctibius grandis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Currently great potoos are not of primary conservation concern. They inhabit a broad geographic region and are capable of long distance dispersal. It is suspected that the population has been drastically decreased with the reduction in forest area associated with slash and burn farming, but remaining populations are estimated to be large.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no adverse effects of great potoos on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Great potoos are of no real economic importance to humans, although they play an important role in their native ecosystems.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Great potoo

The great potoo (Nyctibius grandis) is a bird, both the largest potoo species and the largest member of the order Caprimulgiformes (nightjars and allies). It occurs in tropical America.

Description[edit]

Though related to the nightjars, like other potoos it lacks the bristles around the mouth found in the true nightjars (Caprimulgidae). The great potoo is larger than a crow at 48–60 cm (19-24 inches) tall and 360-650 grams (12.7 oz-1.4 lb). Wingspan in these bird is typically around 70 to 80.4 cm (27.6 to 31.7 in), though larger specimens can attain 100 cm (39 in).[2][3] Among standard measurements, the wing chord is 34.2 to 40 cm (13.5 to 15.7 in), the tail is 22 to 29.5 cm (8.7 to 11.6 in), the bill is 1.6 to 2.2 cm (0.63 to 0.87 in) and the tarsus is 2.6 to 3.7 cm (1.0 to 1.5 in).[4] This potoo's size is distinctive when it is seen. It is pale greyish to brown, finely patterned with black and buff. It has large orange eyes. The overall appearance is pale and grayish. The underside is barred and vermiculated, including the buffy chest. The tail is barred with sharply defined black borders, while the head and back are mottled with gray and buff. Like most members of their order, the great potoo has plumage that is well-suited for camouflage.

The song is described as deep, guttural, strangled cries like borrrrrr or oorrroo repeated after a consistent interval of 10 to 20 seconds. The most common call is a loud, startling bark, BWOW! or GWOK! This call is usually made while the bird is disturbed.

stuffed specimen

Range[edit]

It ranges from southern Mexico through northeastern Guatemala and through most of Central America down through South America as far as Bolivia and southeastern Brazil.

Habitat[edit]

The great potoo is found mostly in dense lowland forest, forest edges and clearings. It may also range into foothills (up to about 1,500 m elevation), second-growth, open woodlands (including plantations) and is sometimes seen around meadows, but they always require trees-etc., for their camouflaged imitative perch.

Ecology[edit]

This nocturnal predator is usually seen perched high above the ground while forgaging, sallying out when prey is spotted. After the pounce, the potoo almost always returns to its previous perch. The prey consists mostly of large flying insects, especially large beetles, katydids and Orthoptera (including crickets and grasshoppers). Bats are also taken. This species uses the sit and wait method where it will sit on an exposed perch waiting for a prey item to fly by then will dart out and return to the branch with it. Very often birds of this species will use the same hunting perch nightly.[5] Normally, during the day it perches upright on a tree stump, and is overlooked because it resembles part of the stump; this is a camouflage, not just by coloration, but a camouflage by the setting. The great potoo can be located at night by the reflection of light from its eyes as it sits vertical on a post, roost, or angled-tree trunk.

Breeding has been recorded as typically February to August, but depending on the portion of this bird's range breeding birds can be met with almost year-round.[6] The nest is a slight depression on a thick tree branch,[7] at least 10 m (33 ft) above ground, with a single white (slightly spotted) egg measuring about 5.2 x 3.8 cm (2 x 1.8 inches). Few details are known of the brooding behavior, but about a month elapses before the offspring is seen alone at the nest. A chick of a few days old weighed 220 g (7.8 oz).[2] After about 5 weeks the nestling is a two-thirds version of the adult, but with a lighter build, paler plumage, shorter tail, and smaller bill with less rectal bristles. The fledging period must be at least 2 months. After this time span, the offspring do not return to the nest site.[2]

Although the adult potoo likely has few natural predators, predation of eggs, nestlings and fledging is apparently not uncommon. Adults stay near the nest throughout the day and rely upon camouflage to protect their offspring. Predators of great potoo nests in Costa Rica have included monkeys such as mantled howlers, Geoffroy's spider monkeys and white-headed capuchins as well as tayras and collared forest falcons.[8]

Status[edit]

The great potoo is normally described as "uncommon", but occurs frequently in areas of less disturbed forests and is often found to be rare along the edges of its range. The clearing of forest is the only conservation threat known to this bird. Due to its large range, it is considered a species of least concern by the IUCN.

References[edit]

  1. ^ BirdLife International (2012). "Nyctibius grandis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Haverschmidt, F. 1948. Observations on Nyctibius grandis in Surinam. The Auk, 65: 30-33.
  3. ^ "Great Potoo: Truths and Legends | Caiman English". En.caiman.com.br. 2010-12-06. Retrieved 2012-08-25. 
  4. ^ Holyoak, D.T. (2001): Nightjars and their Allies: the Caprimulgiformes. Oxford University Press, Oxford, New York. ISBN 0-19-854987-3.
  5. ^ Cohn-Haft, M. 1999. Family Nyctibiidae (Potoos). Pages 288-301 in J. del Hoyo, A. Elliott, and J. Sargatal (editors), 'Handbook of the birds of the world. Volume 5. Barn-owls to Hummingbirds'. Lynx Edicions, Barcelona, Spain.
  6. ^ E.g. an attended nest at Tiputini Biodiversity Station, Ecuador, in late December 1999 (Cisneros-Heredia 2006).
  7. ^ E.g. Ceiba sp. (Cisneros-Heredia 2006)
  8. ^ Young, B., J. Zook. 1999. Nesting of four poorly-known bird species on the Caribbean slope of Costa Rica. The Wilson Bulletin, 111: 124-128.
  • Cisneros-Heredia, Diego F. (2006): Notes on breeding, behaviour and distribution of some birds in Ecuador. Bull. B.O.C. 126(2): 153-164.
  • Holyoak, D.T. (2001): Nightjars and their Allies: the Caprimulgiformes. Oxford University Press, Oxford, New York. ISBN 0-19-854987-3
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!