Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Podager nacunda

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATCTTTGGCGCATGAGCCGGCATAGTAGGAACCGCCCTAAGCCTACTCATCCGTGCCGAGCTAGGCCAACCCGGAACCCTCCTAGGAGACGACCAAATCTACAATGTAATCGTTACAGCTCATGCTTTTGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGCGGGTTCGGAAACTGACTAATTCCACTAATAATTGGAGCCCCAGACATAGCATTCCCCCGCATAAACAACATAAGCTTCTGGCTACTTCCCCCATCCCTCCTTCTATTACTAGCCTCCTCCACAGTAGAGGCGGGAGCCGGTACAGGATGAACAGTATATCCACCACTAGCCGGAAACCTCGCCCACGCCGGAGCATCAGTCGACTTAGCTATCTTCTCCCTACACCTAGCAGGGGTCTCTTCTATCCTAGGCGCAATCAACTTCATCACCACCGCCATTAACATAAAACCTCCTGCCCTTTCACAATACCAAACCCCACTGTTCGTATGATCCGTACTAATCACTGCAGTGTTACTACTCCTGTCTCTCCCAGTATTAGCCGCAGGCATTACCATACTACTAACAGACCGCAACCTAAACACTACATTCTTTGACCCCGCCGGAGGAGGAGACCCAGTACTGTACCAACACCTCTTCTGATTCTTTGGCCACCCAGAAGTATACATCCTCATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Podager nacunda

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Nacunda Nighthawk

The Nacunda Nighthawk (Chordeiles nacunda) is a species of nightjar in the Caprimulgidae family. It was formerly placed in the monotypic genus Podager, but has been reclassified into the genus Chordeiles in 2011.[citation needed] It is found in Argentina, Bolivia, Brazil, Colombia, Ecuador, French Guiana, Guyana, Paraguay, Peru, Suriname, Trinidad and Tobago, Uruguay, and Venezuela. Its natural habitats are dry savanna, subtropical or tropical seasonally wet or flooded lowland grassland, and heavily degraded former forest.

The former generic name "Podager" originates from the Latin meaning "a man suffering from gout" and reflects the awkward walking manner of this nighthawk while the specific name "nacunda" is derived from the Guaraní Indian word for a "big-mouth."[2]

The Nacunda Nighthawk is the largest species of nightjar in the Neotropics, and is one of the largest in the world. In addition to its large size, this species also is noteworthy for its partially diurnal habits. Though a capable aerial forager, the Nacunda Nighthawk spends a considerable amount of time on the ground; it has notably long tarsi for a nightjar, and is more likely than other species to be seen standing on the ground (rather than resting on the surface). The Nacunda Nighthawk is distributed throughout central and eastern South America where it can be found in savanna, grassland, river edges, and disturbed habitats, but is much less common in western Amazonia than elsewhere. Its very large size, large head, and pale body with highly contrasting black primaries make the Nacunda Nighthawk easy to identify. [3]

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!