Articles on this page are available in 1 other language: Spanish (8) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: BREEDING: southern California, northwestern and central Arizona, western Colorado (probably), northern New Mexico, western Texas south to western Peru, Uruguay, Paraguay, Brazil, and Argentina. NON-BREEDING: mostly from northern Mexico (casually from southern California and southern Arizona) south through breeding range. FLAVA group: isolated savannas of southern Guyana and Suriname and northeastern Brazil north of Amazon; interior and southern Brazil, eastern Bolivia, Paraguay, Uruguay, and northern Argentina. LUTEA group: northern coastal mountains of Venezuela, Colombia (locally), western Ecuador, western Peru, and nw. Bolivia; Santa Marta Mountains of Colombia-Venezuela border; slopes of tepuis and other isolated mountains in southern Venezuela, adjacent northern Brazil, Guyana, and Suriname; Trinidad. See Ridgely and Tudor (1989) for further details.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 20 cm

Weight: 38 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Sierra Madre Occidental Pine-oak Forests Habitat

This taxon is found in the Sierra Madre Occidental pine-oak forests ecoregion, which boasts some of the richest biodiversity anywhere in North America, and contains about two thirds of the standing timber in Mexico. Twenty-three different species of pine and about 200 species of oak reside within the Sierra Madre Occidental pine-oak forests ecoregion.

Pine-oak forests here typically grow on elevations between approximately 1500 and 3300 meters, and occur as isolated habitat islands in northern areas within the Chihuahuan Desert. Soils are typically deep, where the incline allows soil build-up and derived from igneous material, although metamorphic rocks also form part of the soils in the west and northwest portions of the sierra. Steep-sloped mountains have shaped some portions of the Sierra, while others are dominated by their deep valleys, tall canyons and cliffs. These steep-sided cliffs have thinner soils limiting vegetation to chaparral types; characterized by dense clumps of Mexican Manzanita (Arctostaphylos pungens), Quercus potosina and Netleaf Oak (Q. rugosa). There are also zones of natural pasture, with grasses from the genera Arisitida, Panicum, Bromus and Stevis.

The pine-oak forests gradually transform into an oak-grassland vegetative association. Such communities represent an ecological transition between pine-oak forests and desert grasslands..  Here, species such as Chihuahuan Oak (Quercus chihuahuensis), Shin Oak (Q. grisea),  Q. striatula and Emory Oak (Q. emoryi), mark a transition zone between temperate and arid environments, growing in a sparse fashion and with a well-developed herbaceous stratum resembling xeric scrub. Cacti are also part of these transition communities extending well into the woodlands. Some cacti species such as the Little Nipple Cactus (Mammillaria heyderi macdougalii), Greenflower Nipple Cactus (M. viridiflora), Mojave Mound Cactus (Echinocereus triglochidiatus), and Leding's Hedgehog Cactus (E. fendleri var. ledingii) are chiefly centered in these biotic communities. The dominant vegetation in the northernmost part of the ecoregion in the Madrean Sky Islands includes Chihuahua Pine (Pinus leiophylla), Mexican Pinyon (P. cembroides), Arizona Pine (P. arizonica), Silverleaf Oak (Quercus hypoleucoides), Arizona White Oak (Q. arizonica), Emory Oak (Q. emoryi), Netleaf Oak (Q. rugosa), Alligator Juniper (Juniperus deppeana), and Mexican Manzanita (Arctostaphylos pungens).

This ecoregion is an important area for bird richness and bird endemism. Likewise, virtually all of the ecoregion is included in the Sierra Madre Occidental and trans-mexican range Endemic Bird Area. Endemic bird species include the Thick-billed Parrot (Rhynchopsitta pachyrhyncha EN) which is in danger of extinction, with population estimates as low as 500 pairs; the Tufted Jay (Cyanocorax dickeyi NT), Eared Quetzal (Euptilptis neoxenus NT) and the Green-striped Brush Finch (Buarremon virenticeps). Temperate and tropical influences converge in this ecoregion, forming a unique and rich complex of flora and fauna. Many other birds are found in this ecoregion including the Green Parakeet (Aratinga holochlora), Eared Trogon (Euptilotis neoxenus NT), Coppery-tailed Trogon (Trogon elegans), Grey-breasted Jay (Aphelocoma ultramarina), Violet-crowned Hummingbird (Amazilia violiceps), Spotted Owl (Strix occidentalis NT), and Golden Eagle (Aguila chryaetos).  Some species found only in higher montane areas are the Gould's Wild Turkey (Meleagris gallopavo mexicana), Band-tailed Pigeon (Patagioenas fasciata), Mexican Chickadee (Poecile sclateri) and Hepatic Tanager (Piranga flava).

The Sierra Madre Mantled Ground Squirrel (Spermophilus madrensis NT) is an endemic to the Sierra Madre Occidental pine-oak forests, restricted to southwestern Chihuahua, Mexico. The Mexican Gray Wolf (Canis lupus baileyi) and Mexican Grizzly Bear (Ursus horribilis), although considered by most to be extinct from this ecoregion, once roamed these mountains. Mammals also present include White-tailed Deer (Odocoileus virginianus), American Black Bear (Ursus americanus), Buller’s Chipmunk (Tamias bulleri), endemic Zacatecan Deer Mouse (Peromyscus difficilis), rock Squirrel (Spernophilis variegatus), Zacatecas Harvest Mouse (Reithrodontomys zacatecae) and Coati (Nasua nasua), to set forth a subset of mammals present.

Reptiles are also numerous in this ecoregion. Fox´s Mountain Meadow Snake (Adelophis foxi) is an endemic taxon to the ecoregion, only observed at the type locality at four kilometers east of  Mil Diez, about  3.2 kilometers west of El Salto, in southwestern Durango, Mexico. There are at least six species of rattlesnakes including the Mexican Dusky Rattlesnake (Crotalis triseriatus), Mojave Rattlesnake (C. scutulatus), Rock Rattlesnake (C. lepidus), Western Diamondback Rattlesnake (C. atrox), Twin-spotted Rattlesnake (C. pricei), and Ridgenose Rattlesnakes (C. willardi).  Clark's Spiny Lizard (Sceloporus clarkii) and Yarrow's Spiny Lizard (S. jarrovii), Bunchgrass Lizard (S. scalaris), and Striped Plateau Lizard (S. virgatus) are several of the lizards found in the Sierra Madre Occidental pine-oak forests.

Along springs and streams the Western Barking Frog (Craugastor augusti) and the Tarahumara Frog (Rana tamahumarae) are two anuran taxa occurring in the ecoregion. Other anuran taxa found here include: Bigfoot Leopard Frog (Lithobates megapoda), Northwest Mexico Leopard Frog (Lithobates magnaocularis) and the Blunt-toed Chirping Frog (Eleutherodactylus modestus VU). The Sacramento Mountains Salamander (Aneides hardii) is an endemic salamander found in the Sierra Madre Occidental pine-oak forests, restricted to the Sacramento Mountains, Capitan Mountains, and Sierra Blanca in Lincoln and Otero Counties within southern New Mexico, USA.

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

© World Wildlife Fund & C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Comments: Open coniferous forest, montane pine-oak forest, riparian woodland, lowland pine savanna; from Costa Rica southward also found in open humid forest, scrub and orchards (AOU 1983); open woodland, tall second growth, forest borders or trees in clearings (Hilty and Brown 1986). Usually nests high in conifer or deciduous tree, on outer end of branch, 4.5-15 m above ground (Terres 1980); in Costa Rica, in niche among bromeliads and other epiphytes on dead branch or dead vertical branch (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Northern populations migratory, but none reach South America (Hilty and Brown 1986). Breeding populations in U.S. generally migrate south of the border after breeding, return in April-May. Costa Rica: mostly descends to lower elevations outside breeding season (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Forages for insects high in trees; also flys out from branch and catches flying insects. Feeds on wild grapes and cherries in late summer. Costa Rica: eats many berries and arillate seeds in addition to insects (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Reproduction

Eggs are laid May-July in north, March-May in Costa Rica. Clutch size is 3-5 in north (usually 4); 2-3 in Costa Rica (Terres 1980, Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Piranga flava

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGACATTCATTACTCGATGATTATTCTCAACCAACCACAAAGATATCGGGACCCTGTACCTAATCTTCGGCGCATGAGCTGGGATAGTAGGTACTGCCCTGAGCCTCCTCATCCGAGCAGAACTGGGACAACCTGGAGCCCTTCTAGGAGACGACCAAGTCTACAATGTTGTCGTCACAGCCCATGCTTTCGTGATAATTTTCTTCATAGTTATGCCAATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATTGGAGCCCCAGACATAGCATTCCCACGAATAAACAACATAAGCTTCTGACTACTCCCCCCATCCTTTCTTCTCCTCCTAGCATCTTCCACCGTAGAAGCAGGTGTCGGCACAGGCTGAACAGTGTACCCTCCACTAGCCGGTAACCTGGCCCACGCTGGAGCCTCAGTTGATCTGGCAATCTTCTCTCTACACCTAGCCGGCATTTCTTCAATCCTGGGGGCCATTAACTTTATCACAACAGCAATCAACATAAAACCCCCTGCCCTCTCACAATATCAAACCCCCCTATTCGTTTGATCCGTCCTAATTACCGCAGTCCTACTACTCCTCTCCCTCCCAGTACTAGCTGCAGGAATCACAATACTCCTCACAGACCGTAACCTCAACACCACATTCTTTGACCCCGCAGGAGGAGGAGACCCTATCCTATACCAACATCTCTTCTGATTCTTCGGCCACCCAGAAG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Piranga flava

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 5,000,000-50,000,000 individuals (A. Panjabi in litt. 2008).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Hepatic tanager

The hepatic tanager (Piranga flava), is a medium-sized American songbird. Formerly placed in the tanager family (Thraupidae), it and other members of its genus are now classified in the cardinal family (Cardinalidae).[2] The species's plumage and vocalizations are similar to other members of the cardinal family.

Female

The common name hepatic means "liver-coloured", namely, brownish-red.[3] The specific name flāva is Latin for yellow or golden.

The habits of the hepatic tanager are similar to those of the western tanager.[4]

It ranges from the southwestern United States (Arizona, New Mexico, and locally in southern California and Colorado) to northern Argentina. There are three subspecies groups, which may be separate species:

  • hepatica group, breeding from Nicaragua north in pine and pine-oak forests and partially migratory
  • lutea group, resident from Costa Rica to northern and western South America in highland forest edges
  • flava group, resident in open woods elsewhere in South America[5]

Members of the northern group are larger and stockier than other Piranga tanagers and have a relatively short tail and a stout bill. Its brightest color is always on its forehead and throat. In all plumages, it has gray flanks, dusky cheeks, and a dark eye streak. The female is yellow, and the male is red. Its average weight is 1.3 oz (38 g). Its average wingspan is 12.5 in (31.8 cm) and length 8 inches (20.3 cm).[4]

Its call is a low, dry chup like the hermit thrush. Its song is clearer than Thraupidae tanagers and far more similar to the song of the black-headed grosbeak, another member of the Cardinalidae. The flight call is a husky and rising weet.[4]

It looks for food in the foliage of trees, moving slowly and methodically; different individuals use different strategies. In summer, the northern form largely eats insects and spiders, and some fruit. In Mexico it has been observed to eat nectar. From Oaxaca south it follows swarms of army ants.[5]

Even the northern population's behavior and life history are remarkably little known.[5]

References[edit]

  1. ^ BirdLife International (2012). "Piranga flava". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Remsen, J. V., Jr., C. D. Cadena, A. Jaramillo, M. Nores, J. F. Pacheco, M. B. Robbins, T. S. Schulenberg, F. G. Stiles, D. F. Stotz, and K. J. Zimmer. Version [2009-04-02]. A classification of the bird species of South America. American Ornithologists' Union.
  3. ^ "hepatic". Oxford English Dictionary (3rd ed.). Oxford University Press. September 2005. 
    “(adj.) Liver-coloured, dark brownish-red; as in hepatic aloes, hepatic tanager.”
  4. ^ a b c Sibley, David (2003). The Sibley Field Guide to Birds of Western North America. ISBN 0-679-45121-8. 
  5. ^ a b c Eddleman, William R. 2002. Hepatic Tanager (Piranga flava), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: The form occuring from the US to Northern Nicaragua is recognized by some as Piranga hepatica and the form occurring from Costa Rica through the Andes to Bolivia and across northern South America as Piranga lutea, but in this treatment are considered part of P. flava.

Mitochondrial genetic data from several studies (Burns 1997; Burns et al. 2002, 2003; Klicka et al. 2000, 2007) provide strong evidence that this genus, previously placed in the Thraupidae, is a member of the Cardinalidae.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!