Overview

Distribution

Range Description

This species is endemic to Australia. Subspecies pastinator is found in most of south-west Australia, south of Perth from the Swan and Avon rivers in the north, to Augusta in the west and Broome in the east. Subspecies derbyi is found in the northern wheatbelt of Western Australia.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 26.3 years (captivity) Observations: One specimen lived 26.3 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cacatua pastinator

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGCACCGCCTTAAGCCTACTTATCCGCGCAGAACTTGGTCAACCAGGGACCTTACTAGGAGACGACCAGATCTACAATGTAATCGTCACTGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATGCCAATCATAATTGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGTGCCCCCGATATAGCATTCCCGCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTCCTCCTACTAGCCTCATCCACAGTTGAAGCTGGAGCGGGCACAGGATGGACTGTTTACCCCCCCTTAGCCGGAAACCTAGCCCATGCCGGAGCATCAGTAGACCTAGCCATCTTTTCCCTCCACCTAGCAGGTGTATCTTCCATCCTAGGGGCTATCAACTTTATCACTACTGCCATCAACATAAAACCACCCGCTCTATCACAATATCAAACCCCACTGTTCGTCTGATCGGTCCTTATTACCGCCGTACTACTCCTACTATCCCTTCCAGTCCTAGCAGCTGGCATCACCATGCTCCTCACAGACCGCAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGGGACCCAATCCTATACCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTGTACATCCTCATCCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Cacatua pastinator

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the population size for the nominate subspecies has been estimated as c.3,000 individuals (Garnett and Crowley 2000).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Subspecies pastinator declined significantly in range and numbers early in the 20th century, as it was considered an agricultural pest. Extensive shooting and poisoning by farmers caused the population to plummet to c.100 birds in the 1940s. However, both the expansion of agriculture and prohibition of poisoning and shooting has allowed a recovery in numbers (Garnett and Crowley 2000). Clearance for agriculture has reduced the area of breeding habitat for subspecies derbyi, and may be favouring the Short-billed Corella C. sanguinea. Nevertheless, despite a low reproductive rate, the range of this subspecies has expanded in recent decades (Garnett 1992).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Western corella

The western corella (Cacatua pastinator) formerly known as the western long-billed corella, is a species of white cockatoo endemic to south-western Western Australia.

Taxonomy[edit]

The western corella was formerly considered either a subspecies of the little corella or the long-billed corella, before being recognised as a full species. There are two subspecies:

Aviculture[edit]

This species has the ability to mimic clearly and, like other cockatoos, bonds strongly to its owner. The western corella may show aggression to other birds in the aviary. It is not as common in aviculture as the little corella or long-billed corella.

Status and conservation[edit]

Cacatua pastinator pastinator in Perth, Western Australia

While generally uncommon, it has expanded its range in recent decades, and is therefore listed as of least concern by BirdLife International. However, the nominate subspecies, Muir's corella, is relatively rare, with a population of around 3000 individuals, and is considered to be nationally Vulnerable.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!