Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 46.9 years (captivity) Observations: These animals have been reported to be able to reproduce up until they are around 40 years old. One specimen lived 46.9 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cacatua sanguinea

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TTGGCACCGCCTTAAGCCTACTTATCCGCGCAGAACTTGGTCAACCAGGGACCTTACTAGGAGACGACCAGATCTACAATGTAATCGTCACTGCCCATGCTTTCGTAATAATTTTCTTCATAGTTATGCCAATCATAATTGGAGGATTTGGAAACTGACTAGTCCCCCTTATAATTGGTGCCCCCGATATAGCATTCCCGCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTCCTCCTACTAGCCTCATCCACAGTTGAAGCTGGAGCGGGCACAGGATGGACTGTTTACCCCCCCCTAGCCGGAAACCTAGCCCATGCCGGAGCATCAGTAGACCTAGCCATCTTTTCCCTCCACCTAGCAGGCGTATCTTCCATCCTAGGGGCCATCAACTTTATCACTACTGCCATCAACATAAAACCACCCGCTCTATCACAATATCAAACCCCACTGTTCGTCTGATCGGTCCTTATTACCGCCGTACTACTCCTACTATCCCTTCCAGTCCTAGCAGCTGGCATCACCATGCTCCTCACAGACCGCAACCTAAACACCACATTCTTTGACCCCGCTGGAGGAGGGGACCCAATCCTATACCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTGTACATCCTCATCCTTCCAGGATTTGGAATTATC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cacatua sanguinea

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as common throughout inland and northern Australia (del Hoyo et al. 1997).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Little Corella

The Little Corella (Cacatua sanguinea), also known as the Bare-eyed Cockatoo, Blood-stained Cockatoo, Short-billed Corella, Little Cockatoo and Blue-eyed Cockatoo, is a white cockatoo native to Australia and southern New Guinea.[2] It was known as Birdirra among the Yindjibarndi people of the central and western Pilbara. They would keep them as pets, or traditionally cook and eat them. The downy feathers are used in traditional ceremonies and dances where they adorn head and armbands.[3]

Taxonomy[edit]

The species was originally described by English ornithologist John Gould in 1843.[1] There are four subspecies as follows:[2]

  • C. s. sanguinea
  • C. s. normantoni
  • C. s. transfreta
  • C. s. gymnopis

Description[edit]

In Australia

The Little Corella is a small white cockatoo growing to 35–41 cm (14–16 in) in length and weighs 370–630 g (13–22 oz), with a mean weight of 525 g (1.157 lb).[4][5] It is similar in appearance to both the Long-billed Corella and the Western Corella, but the Little Corella is smaller, and unlike either of those species, it has upper and lower mandibles are of similar length. It is easily distinguished from the Long-billed Corella by the lack of an orange throat bar.[6] C. s. normantoni and C. s. normantoni are a little smaller than the nominate form.[2] C. s. normantoni is lightly brownish on the underside of flight and tail feathers.[2] C. s. gymnopis has darker blue eye-rings, more strongly marked pink lores and a yellow wash to the lower-ear coverts.[2] Females are slightly smaller than males in weight, wing length, culmen size, tarsus length, tail length and eye ring diameter.[7]

Distribution and Habitat[edit]

The nominate form, C. s. sanguinea is found in Northern Australia. C. s. normantoni is found on the Western Cape York Peninsula.[2] C. s. transfreta is found in New Guinea.[2] C. s. gymnopis is found in Central, Eastern, and South-eastern Australia.[2] Habitat ranges from the arid deserts of central Australia to the eastern coastal plains, but they are not found in thick forests. Little Corellas can also be found in urban areas, including Sydney and Brisbane, where they feed on lawns and playing fields. They are numerous in farmlands throughout New South Wales and Queensland and have become so common in some areas that it has become something of a pest, and can be destructive to the trees in which it perches, by chewing the bark off smaller twigs.

Behaviour[edit]

Little Corellas congregate in flocks of up to several thousand, which often include other birds such as Galahs, Sulfur-crested Cockatoos and Red-tailed Black Cockatoos. They generally roosts in trees overnight, and fly off to feed in the early morning before returning in the late evening. Flocks will often fly many kilometers between their feeding and roosting areas, and in desert areas must also fly to watering holes twice a day, while corellas who live in coastal areas do not have to fly long distances to find water.

Call[edit]

The call consists of high pitched notes and screeches somewhat similar to the Sulfur-crested Cockatoo. Large flocks will call simultaneously and can create a defeaning screeching sound audible from several kilometers away.

Breeding[edit]

Breeding occurs from May to October, and usually takes place earlier in the north of its range.[6] The nest is usually in a tree hollow, cliff cavity or termite mound.[6]

Feeding[edit]

Little Corellas usually feed on the ground, however occasionally feed in trees and shrubs. They eat a variety of both wild and cultivated seeds and regularly feed on lawn grasses in urban areas. They frequently feed on cereal crops such as wheat, barley and corn and can become a considerable agricultural pest in some areas.

Playing[edit]

When Little Corellas play, they become very noisy. They have conversations with each other, fly around and also show off. Little Corellas show off by hanging themselves upside-down with their feet, beaks or both.

References[edit]

  1. ^ a b BirdLife International (2012). "''Cacatua sanguinea''". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f g h Mike Parr, Tony Juniper (2010). Parrots: A Guide to Parrots of the World. A&C Black. ISBN 9781408135754. 
  3. ^ Juluwarlu Aboriginal Corporation (2005). Garruragan: Yindjibarndi Fauna. Juluwarlu Aboriginal Corporation. p. 9. ISBN 1-875946-54-3. 
  4. ^ CRC Handbook of Avian Body Masses by John B. Dunning Jr. (Editor). CRC Press (1992), ISBN 978-0-8493-4258-5.
  5. ^ [1] (2011).
  6. ^ a b c Pizzey, Graham; Knight, Frank (1997). Field Guide to the Birds of Australia. Sydney, Australia: HarperCollinsPublishers. p. 265. ISBN 0-207-18013-X. 
  7. ^ Sauders, D. A. Measurements of the Little Corella from Kununurra, WA. CSIRO. 
  • Flegg, Jim. Birds of Australia: Photographic Field Guide Sydney: Reed New Holland, 2002. (ISBN)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!