Overview

Distribution

Range Description

This species is endemic to Australia. The nominate subspecies is very widespread across semi-arid woodland in eastern Australia. It disappeared from the Adelaide and Mt Mary plains by the 1950s, and density has been greatly reduced in north-west Victoria and western New South Wales. Subspecies mollis is found in the central and western arid zone and Nullabor, west of the Eyre basin and Port Augusta.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Cacatua leadbeateri is endemic to Australia and inhabits interior central and southwest areas. The subspecies C. l. leadbeateri can be found in eastern Australia, whereas the subspecies C. l. mollis is found in central and western Australia.

Biogeographic Regions: australian (Native )

  • Bird Life International. 2009. "Major Mitchell's Cockatoo" (On-line). Bird Life International. Accessed March 19, 2010 at http://www.birdlife.org/datazone/species/index.html?action=SpcHTMDetails.asp&sid=1397.
  • Forshaw, J., F. Knight. 2010. Parrots of the World. Princeton, NJ: Princeton University Press.
  • Rowley, 1991. The Breeding Biology, Food, Social-Organization, Demography and Conservation of the Major Mitchell or Pink Cockatoo, Cacatua leadbeateri, on the Margin of the Western Australian Wheat Belt. Australian Journal of Zoology, 39: 211-261.
  • del Hoyo, J., A. Elliott, J. Sargatal. 1997. Handbook of Birds of the World; Vol. 4 Sandgrouse to Cuckoos. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Cacatua leadbeateri is a small to medium size bird weighing 300 to 450 grams. They range from 35 to 40 centimeters long with a wing span of roughly 81 centimeters.  Cacatua leadbeateri is a distinctively colored species, and is often referred to as the "pink cockatoos". These birds have a white back, tail, and wings. Its breast, head, and stomach can vary in color from pale salmon to robust pink. The underside of the wings and base of the tail is similar in color to their breast and stomach, but often richer and deeper in color. Just before the crest is a white patch of plumage with a red frontal band above the bill. Cacatua leadbeateri is most known for its prominent crest. The crest is banded red-yellow-red with white tips. The crest’s bands can help to distinguish the two subspecies. Subspecies C. l. leadbeateri has a more prominent yellow band while subspecies C. l. mollis has little to no yellow in the crest. Their feet are gray. Cacatua leadbeateri has a very strong bill which is off-white or pale beige in color and decurved at the very tip. Its eyes range from dark brown in males to a lighter reddish brown in females.

Females are very similar to males in plumage, except that their plumage is duller with a white upper belly. Their crest may have a slightly larger yellow band than males. The females are also slightly smaller. Juveniles resemble females but with even paler plumage, light brown eyes, and duller frontal band.

Range mass: 300 to 450 g.

Range length: 35 to 40 cm.

Average wingspan: 81 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike; male larger; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cacatua leadbeateri lives in arid to semiarid regions with nearby water sources. These birds inhabit scrublands, wooded grasslands, and savannas but rely on forested areas for nesting habitat. They require tall, hollow trees to nest in. They prefer areas with Callitris, Allocasuarina, and Eucalyptus plants for foraging and will roam nomadically to find adequate food resources. Cacatua leadbeateri inhabits inland Australia, but is never far from a water source.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Cacatua leadbeateri feeds on seeds, nuts, grains, fruits and tubers. They often select habitats that feature trees of the genus Callitris, Allocasuarina, Acacia and Eucalyptus to forage on. They forage both in the trees and on the ground. Their large bills aid in cracking open thick-shelled nuts and seeds, as well is breaking open tree branches to access insect larvae. These cockatoos may turn to agricultural grains when native food resources are in short supply.

Animal Foods: insects

Plant Foods: roots and tubers; seeds, grains, and nuts; fruit

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Cacatua leadbeateri consume fruit and seeds of many native plants and likely serve as an important seed disperser for Australian ecosystems.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Local species of falcons and eagles are predators to Cacatua leadbeateri. Red foxes and cats also prey upon this species.

Known Predators:

  • Falcons
  • Eagles
  • Red foxes (Canis vulpes)
  • Cats (Felis catus)

  • Forshaw, J. 1978. Parrots of the World. Second Edition. Newton Abbot, Devon, UK: David and Charles Ltd.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cacatua leadbeateri has a characteristic “creek-ery-cree” call that can be heard at incredible distances. As in most cockatoos, the frequency of the call acts as a mood indicator with more frequent call characterizing stress. It uses a soft contact call, with a frequency of one call per minute, when foraging and even softer calls when it is about to feed its young. Their crest is also used to visually attract a mate, ward off opposing males, and communicate alarm or distress to nearby birds. As part of the mating rituals, males will visually display to females with head bobbing, body swaying and wing raising. Mated pairs use allopreening to reinforce their lifelong bond. Like all birds, Cacatua leadbeateri perceives its environment through visual, tactile, auditory and chemical stimuli.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Cacatua leadbeateri is a long-lived species. They live to be 50 to 60 years old in the wild. The oldest known bird of this species is an individual named "Cookie" who lives at the Brookfield Zoo and as of June 2010 was 77 years old.

Range lifespan

Status: captivity:
77 (high) years.

Typical lifespan

Status: wild:
50 to 60 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 63.6 years (captivity) Observations: One specimen was still alive after 63.6 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Cacatua leadbeateri is a monogamous species and forms life-long pair bonds. Courtship consists of visual displays where the male struts while bobbing his head, swaying, and lifting his wings for the female. The female raises her crest and bows in response, and the two softly chatter to each other. If the female accepts him they proceed to allopreen and occasionally feed each other.

Mating System: monogamous

The breeding season for Cacatua leadbeateri typically begins in August and lasts through December, but some northern populations can begin breeding as early as May. Cacatua leadbeateri is a cavity nesting species, and selects a hollow 3 to 20 m above ground, preferably in a eucalyptus tree near water. This species is unable to excavate new cavities and relies on natural hollows or those constructed by other species. Both male and female construct the nest by gathering bits of wood and pebbles. The same nest is often used year after year. Pairs are very territorial and must nest at least one kilometer from other breeding pairs. Two to five eggs are laid at an interval of one every 2 to 3 days. Incubation lasts 23 to 30 days and the young remain in the nest for six to eight weeks before they fledge. Parents, mostly the male, continue to feed fledgelings for 8 additional weeks. Juveniles join their parents to form small, family groups that remain together for some time after the young reach independence. Juveniles reach sexual maturity at 3 to 4 years of age.

Breeding interval: Cacatua leadbeateri breeds once a year.

Breeding season: The breeding season occurs from August to December, but can begin as early as May in northern populations.

Range eggs per season: 2 to 5.

Range time to hatching: 23 to 30 days.

Average time to hatching: 26 days.

Range fledging age: 6 to 8 weeks.

Average fledging age: 8 weeks.

Average time to independence: 8 weeks.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Cacatua leadbeateri is very territorial during the breeding season, and likely expends significant energy defending its large territory of 30 square kilometers. Both the male and female participate in gathering nesting materials. After eggs are laid, both parents take turns incubating the clutch, with the male generally brooding during the day and the female at night. Chicks are born altricial, without feathers and with eyes closed, and require significant parental care. Parents tend to the chicks while in the nest for six to eight weeks until they fledge. They will continue to be fed by the parents, primarily by the male, for another 8 weeks when they reach independence. Juveniles often remain with the parents to form family groups.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • del Hoyo, J., A. Elliott, J. Sargatal. 1997. Handbook of Birds of the World; Vol. 4 Sandgrouse to Cuckoos. Barcelona: Lynx Edicions.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cacatua leadbeateri

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GCCTTAAGCCTACTTATCCGTGCAGAACTAGGTCAACCAGGAACCTTACTAGGAGATGACCAGATCTACAATGTAATCGTCACTGCCCATGCTTTCGTAATAATCTTTTTCATAGTAATGCCAATTATAATTGGAGGATTTGGAAATTGACTAGTTCCCCTTATAATTGGTGCCCCCGATATAGCATTCCCCCGCATAAACAACATAAGCTTCTGGCTTCTCCCCCCCTCCTTTCTCCTACTACTAGCCTCATCCACAGTTGAAGCTGGAGCGGGCACAGGGTGAACTGTCTACCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGAGCATCAGTAGACCTAGCCATCTTTTCTCTCCACCTAGCAGGCGTATCTTCCATCCTAGGAGCCATCAACTTTATCACCACTGCTATCAATATAAAACCACCTACCCTATCACAATATCAAACCCCACTATTCGTCTGATCCGTCCTTATCACCGCCGTACTACTCCTACTATCCCTTCCAGTCCTAGCTGCTGGTATTACCATACTCCTCACAGACCGCAATCTAAACACCACATTCTTCGATCCCGCTGGAGGGGGAGATCCAATCCTATACCAACATCTCTTCTGATTCTTTGGCCACCCAGAAGTATATATCCTAATCCTACCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cacatua leadbeateri

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 6
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cacatua leadbeateri populations have been declining in recent years due to habitat loss and fragmentation. Much of its forest habitat has been cleared for farms and agricultural fields. These birds nest in tree hollows, but are unable to excavate cavities themselves and thus rely on natural hollows or those constructed by other species. The harvesting of old-growth forests has drastically decreased the number of natural tree cavities for nesting. The IUCN Red List categorizes this species as of least concern although many local efforts have been made to support the species. Because of this species' high market value in the pet industry, populations are threatened by humans who illegally collect eggs, chicks, or adults. These birds are often hesitant to fly across open, tree-less habitats, thus efforts are underway to create vegetation corridors to increase habitat connectivity. Cacatua leadbeateri occasionally feeds on agricultural crops, and illegal persecution by farmers is common as removing several other, similar species of cockatoo is legal. Local efforts are being made to increase public awareness and understanding of this endemic species.

CITES: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but it is believed to be large as the species is described as common in at least parts of its range (del Hoyo et al. 1997). The nominate subspecies is thought to number c.50,000 individuals, whilst the subspecies mollis has a large and stable population.

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
Clearance of feeding and breeding habitat has substantially reduced the population of leadbeateri in the southern and eastern parts of its range, and is continuing. Grazing and weed invasion are also impeding recruitment of trees that could be used for breeding in the future. Nest robbing and trapping for aviculture are thought to have been a major cause of decline in South Australia and may be a significant threat elsewhere in the range. Subspecies mollis is probably largely unaffected by these threats (Garnett and Crowley 2000).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are little negative effects of Cacatua leadbeateri on humans, but when food resources are scarce birds may feed on agricultural crops.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Cacatua leadbeateri is a beautiful and charismatic species and likely brings ecotourism to areas it inhabits. They are also a popular captive pet.

Positive Impacts: pet trade

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Major Mitchell's Cockatoo

The Major Mitchell's cockatoo (Lophochroa leadbeateri) also known as Leadbeater's cockatoo or pink cockatoo,[2] is a medium-sized cockatoo restricted to arid and semi-arid inland areas of Australia. It is here placed in its own monotypic genus Lophochroa, though to include it in Cacatua as others do is not wrong as long as the corellas are also included there.[3][4]

Description[edit]

Adult perched on a tree in Melbourne Zoo

With its soft-textured white and salmon-pink plumage and large, bright red and yellow crest, it is generally recognised as the most beautiful[peacock term] of all cockatoos. It is named in honour of Major Sir Thomas Mitchell, who wrote, "Few birds more enliven the monotonous hues of the Australian forest than this beautiful species whose pink-coloured wings and flowing crest might have embellished the air of a more voluptuous region."[5]

Sexing[edit]

Major Mitchell females and males are almost identical. The males are usually bigger. The female has a broader yellow stripe on the crest and develop a red eye when mature.[6]

Systematics and naming[edit]

It is possible, though not certain, that the Major Mitchell's cockatoo is more closely related to Cacatua than is the galah, and that its lineage diverged around the time of or shortly after the acquisition of the long crest – probably the former as this crest type is not found in all Cacatua cockatoos and therefore must have been present in an early or incipient stage at the time of the divergence of the Major Mitchell's cockatoo's ancestors. Like the galah, this species has not lost the ability to deposit diluted pigments dyes in its body plumage, although it does not produce melanin coloration anymore, resulting in a lighter bird overall compared to the galah. Indeed, disregarding the crest, Major Mitchell's cockatoo looks almost like a near-leucistic version of that species (see also "External links" below). Another indication of the early divergence of this species from the "white" cockatoo lineage is the presence of features found otherwise only in corellas, such as its plaintive yodeling cry, as well as others which are unique to Major Mitchell's and the true white cockatoos, for example the large crest and rounded wing shape.[3]

The scientific name commemorates the British naturalist, Benjamin Leadbeater. In Central Australia south of Alice Springs, the Pitjantjatjara term is kakalyalya.[7]

Distribution and habitat[edit]

In contrast to those of the galah, populations of the Major Mitchell's cockatoo have declined rather than increased as a result of man-made changes to the arid interior of Australia. Where galahs readily occupy cleared and part-cleared land, Major Mitchell's cockatoo requires extensive woodlands, particularly favouring Callitris, Allocasuarina and Eucalyptus. Unlike other cockatoos, Major Mitchell pairs will not nest close to one another, so they cannot tolerate fragmented, partly cleared habitats, and their range is contracting.

In the Mallee region of Victoria where the galah and Major Mitchell's cockatoo can be found to be nesting in the same area, there have been occasions where the two species have interbred and produced hybridised offspring.[8]

Conservation status[edit]

Australia[edit]

Major Mitchell's cockatoo is not listed as a threatened species on the Environment Protection and Biodiversity Conservation Act 1999.

Victoria[edit]

  • Major Mitchell's cockatoo is listed as a threatened species on the Victorian Flora and Fauna Guarantee Act (1988).[9] Under this Act, an Action Statement for the recovery and future management of this species has been prepared.[10]
  • On the 2007 advisory list of threatened vertebrate fauna in Victoria, this species is listed as vulnerable.[11]
Cookie, a cockatoo that is 80 years old, housed in Brookfield Zoo

Aviculture[edit]

One Major Mitchell's cockatoo that has become quite famous is "Cookie," a beloved resident of Illinois' Brookfield Zoo near Chicago since it opened in 1934. Cookie is 80 years old and has retired from actively being displayed. He currently resides in the keeper's office at the Perching Bird House.

Gallery[edit]

References[edit]

  1. ^ BirdLife International (2012). "Cacatua leadbeateri". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b Cacatua leadbeateri on Avibase
  3. ^ a b Brown, D.M. & Toft, C.A. (1999): Molecular systematics and biogeography of the cockatoos (Psittaciformes: Cacatuidae). Auk 116(1): 141-157.
  4. ^ Les Christidis & Walter E Boles (2008) Systematics and Taxonomy of Australian Birds, CSIRO Publishing
  5. ^ John Gould (1865). Handbook to The Birds of Australia, Volume 2. 
  6. ^ Major Mitchell's Cockatoo Handbook of the Birds of the World
  7. ^ Cliff Goddard (1992). Pitjantjatjara/Yankunytjatjara To English Dictionary (2 ed.). Alice Springs, Northern Territory: Institute for Aboriginal Development. p. 26. ISBN 0-949659-64-9. 
  8. ^ Hurley. V, The State of Australias Birds 2008, Major mitchell's Cockatoo: changing threats, Birds Australia, p. 8 ISSN: 1036-7810
  9. ^ Department of Sustainability and Environment, Victoria
  10. ^ Department of Sustainability and Environment, Victoria
  11. ^ Victorian Department of Sustainability and Environment (2007). Advisory List of Threatened Vertebrate Fauna in Victoria - 2007. East Melbourne, Victoria: Department of Sustainability and Environment. p. 15. ISBN 978-1-74208-039-0. 

Further reading[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!