Overview

Brief Summary

Description

With its pristine white plumage and striking, bright yellow crest, the sulphur-crested cockatoo is one of Australasia's most recognisable parrot species (2) (4). The crest is erectile and can reach up to 14 centimetres in length (2). The undersurfaces of the wings and tail are washed with pale yellow, while the bill and feet are black and dark-grey respectively. The sexes are almost identical, except for the eye, which is brown in the male and red-brown in the female. There are four recognised subspecies of sulphur-crested cockatoo which are distinguished by location, as well as by differences in body size, bill size, and the colouration around the eye, which is white in all of the subspecies except for Cacatua galerita fitzroyi,in which it is blue (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Biology

Noisy and conspicuous (4), the sulphur-crested cockatoo forms large flocks of up to several hundred birds (2). As the famous naturalist Charles Darwin observed during his visit to Australia, these flocks are commonly found feeding in wheat fields, and are considered to be pests by many Australian wheat farmers (5). During feeding some members of the flock stand guard on a nearby perch, alerting the rest of the group to any danger by making a raucous alarm call (2) (4). When not feeding, the sulphur-crested cockatoo will frequently bite off smaller branches and leaves, which helps prevent the bill from growing too large. A similar behaviour is also employed by this species in urban environment, causing widespread damage to wooden panelling and timber decking (4). Flocks spend the night at a permanent roosting site, usually in trees, but may travel over several kilometres during the day in search of food (2) (6). The sulphur-crested cockatoo's breeding season varies according to location, with populations in southern Australia breeding between August and January, and populations in northern Australia breeding from May to September. Once formed, each breeding pair constructs a nest well apart from the other pairs, which usually comprises a bed of woodchips in a tree hollow. A clutch of two to three eggs is laid, which are incubated by both parent birds, with hatching taking place after 25 to 27 days. Nestlings remain in the hollow for 9 to 12 weeks and are fed by both adults, before fledging and joining a feeding flock (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Geographic Range

Cacatua galerita is native to the Australian Region and occurs in large numbers in the north and east of Australia. It has been introduced to western Australia, New Zealand and New Guinea.

Biogeographic Regions: australian (Introduced , Native ); oceanic islands (Introduced )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Range

The nominate subspecies Cacatua galerita galerita has the largest range, occupying eastern and south-eastern Australia, from Cape York, south to Tasmania. It has also been introduced to south-western Australia and New Zealand. Cacatua galerita fitzroyi is found in northern Australia from the Fitzroy River in the north-west to the Gulf of Carpenteria in the north-east. Cacatua galerita eleonora is found only on the Aru Islands, Indonesia, while Cacatua galerita triton is found in New Guinea and surrounding islands, with introduced populations also inhabiting the islands of Seram Laut and Kai in the Moluccas and Palau Island in the central-western Pacific (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Sulphur-crested cockatoos are large birds, measuring 45 to 50 centimeters in length. Their average weight is 800 grams. Sulphur-crested cockatoos are white with a distinctive sulphur-yellow crest which can be erected or held folded down on top of head. The underside of their wings and tail is pale yellow. Females and males are similar in appearance (monomorphic); however, females can be identified at close range by their red tinted brown eyes, whereas males have darker brown eyes. There are four subspecies of sulphur-crested cockatoos. Cacatua galerita fitzroyi differs from C. g. galerita in having a pale blue eye ring instead of white, the yellow feathers are slightly darker, and the crest feathers are longer. Cacatua galerita eleonora and C. g. triton both average smaller in overall size than C. g. galerita.

Range mass: 700 to 950 g.

Average mass: 800 g.

Average length: 50 cm.

Average wingspan: 103 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently

Average basal metabolic rate: 3.419 W.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sulphur-crested cockatoos dwell in a variety of timbered habitats such as tropical and subtropical rainforests. They are also found in the vast savannas of northern Australia. Sulphur-crested cockatoos also occur in suburban and urban areas, especially in parks and gardens.

Range elevation: 0 to 1450 m.

Average elevation: 300-600 m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest

Other Habitat Features: urban ; suburban

  • Sibley, C., B. Monroe. 1990. Distribution and Taxonomy of Birds of the World. New Haven: Yale University Press.
  • Cody, M. 1993. Bird diversity components within and between habitats in Australia. Pp. 147-158 in R Ricklefs, D Schluter, eds. Species Diversity in Ecological Communities: Historical and Geographical Perspectives. Chicago, IL: The University of Chicago Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

In Australia, the sulphur-crested cockatoo inhabits forest, woodland and cultivated cropland, while in New Guinea it occurs in lowland forest up to elevations of 1,400 metres (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Sulphur-crested cockatoos are primarily granivores in the wild, feeding both on the ground and in trees. They feed mainly on seeds, nuts, fruits, blossoms, insects and insect larvae. They will also attack newly planted and ripening grain crops.

In captivity, C. galerita are mainly fed a diet of fresh fruits, vegetables, seeds, nuts, pellets, legumes and grains. They have a high rate of obesity so high fat foods such as peanuts and seeds are fed sparingly.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Frugivore , Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

The role of sulphur-crested cockatoos in the ecosystems they inhabit is not well documented. They feed on seeds and nuts and may play a role in seed dispersal.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Sulphur-crested cockatoos have one primary method of detecting and avoiding predators. When feeding, a few 'sentinel' birds will perch in a tree looking out for predators. They unleash their deafening warning call when a potential predator is sighted. Their large size also protects them from predation by all but the largest birds of prey.

During the incubation period and 6 to 10 weeks thereafter, both parent birds are intentionally very quiet in order not to attract predators to their nest.

Sulphur-crested cockatoos are known to be preyed on by powerful owls (Ninox strenua). Goannas (Varanus) are also potential predators of birds on the ground, fledglings, and nestlings. Other potential predators include common avian nest predators such as pied currawongs (Strepera graculina), butcherbirds (Cracticus), and ravens.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Sulphur-crested cockatoos are noisy birds. Their primary method of communication is their screeching voices. They also use their crest to communicate emotion. They will raise and spread their magnificent crests when excited, such as when danger is detected or during mating.

Communication Channels: visual ; acoustic

Other Communication Modes: mimicry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Sulphur-crested cockatoos can live for decades in the wild. Average lifespan is about 40 years, but they can live up to 100 years. In captivity, sulphur-crested cockatoos that are well-cared for can live for 65 years on average and up to 120 years.

Range lifespan

Status: wild:
57 (high) years.

Average lifespan

Status: wild:
40 years.

Range lifespan

Status: captivity:
120 (high) years.

Average lifespan

Status: captivity:
65 years.

Average lifespan

Status: wild:
40 years.

Average lifespan

Status: captivity:
65 years.

Average lifespan

Status: captivity:
57 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 57 years (captivity) Observations: There are anecdotal reports of animals living over 100 years. Presently, however, the record longevity belongs to one captive specimen called "Cocky" that lived over 57 years at London Zoo (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Sulphur-crested cockatoos are monogamous birds. Signs of courtship include raising of the crest, bobbing of the head, and moving the head from side to side in a figure-of-eight pattern while uttering soft chattering notes. Before mating, the birds usually preen each other's plumage.

Mating System: monogamous

In the northern parts of their range, sulphur-crested cockatoos breed from May to September, whereas birds in the southern parts of their range breed from August to January. They generally nest in a high tree hollow, usually near water. They breed once yearly, producing a clutch containing 2 to 3 white oval eggs. Eggs hatch after an incubation period of 27 to 30 days. Fledging generally occurs at approximately 70 days. Offspring will leave the nest after this 70 day period but will remain with the parents year round. Family units will remain together indefinitely. Both male and female Cacatua galerita reach reproductive maturity around the age of 3 to 4 years.

Breeding interval: Sulphur crested cockatoos breed once yearly.

Breeding season: Sulphur-crested cockatoos breed between August and January in the southern parts of their range and between May and September in the northern parts of their range.

Range eggs per season: 2 to 3.

Average time to hatching: 27 days.

Average fledging age: 70 days.

Average age at sexual or reproductive maturity (female): 3 to 4 years.

Average age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average time to hatching: 27 days.

Average eggs per season: 2.

Both parents incubate their clutch. Once the eggs hatch, chicks are fed by both parents.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female); post-independence association with parents

  • Cambridge University Press. 1991. Pp. 33 in M Brooke, T Birkhead, eds. The Cambridge Encyclopedia of Ornithology. Cambridge: Cambridge University Press.
  • Equinox. 1985. Pp. 220-230 in D Perrins, D Middleton, eds. The Encyclopedia of Birds. New York: Facts on File, Inc..
  • Dobbs, S., C. Highfill. 2003. "Birds n Ways" (On-line). Accessed October 12, 2006 at http://www.birdsnways.com/cockatoo/sc.htm.
  • Forshaw, J. 2002. Parrots. Pp. 275-298 in J Jackson, W Bock, D Olendorf, M Hutchins, eds. Grzimek's Animal Life Encyclopedia, Vol. Volume 9, Second Edition. Detroit: Gale.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Cacatua galerita

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCCTAAGCCTACTTATCCGCGCAGAACTTGGTCAACCAGGAACCTTACTAGGAGACGACCAGATCTACAATGTAATCGTCACTGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGGTTTGGAAACTGACTGGTCCCTCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTCCTCCCTCCTTCCTTCCTCCTCCTACTAGCCTCATCCACAGTTGAAGCAGGGGCAGGCACAGGATGGACTGTCTACCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGAGCATCAGTAGACCTAGCCATCTTTTCCCTCCACTTGGCGGGCGTATCTTCCATCCTAGGGGCAATCAACTTTATCACCACTGCCATCAATATAAAACCACCTGCCCTATCACAATACCAGACCCCACTGTTCGTCTGATCTGTCCTTATCACTGCTGTATTACTTCTACTATCCCTCCCTGTCCTGGCTGCTGGTATCACTATACTCCTCACAGACCGCAACCTAAACACCACATTCTTTGATCCTGCTGGAGGGGGAGACCCAATCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCAGAAGTATACATCCTTATCCTCCCTGGATTCGGAATCATCTCACATGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Cacatua galerita

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 10
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Sulphur-crested cockatoos are generally common and abundant. Their population is approximated at more than 500,000 individuals. It is no longer legal to import these birds to the United States as a result of the Wild Bird Conservation Act.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

There are currently no major threats to the sulphur-crested cockatoo. Whilst this species is popular as an aviary bird, international trade is regulated and its global population is very large (2) (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

The sulphur-crested cockatoo is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES), which regulates international trade in this species through the use of permits and annual quotas (3). While this regulation remains in place, there is little cause for concern regarding this species' survival (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Sulphur-crested cockatoos can be so numerous in crop growing areas that they are often shot or poisoned as pests. Government permit is required, though, as they are a protected species under the Australian Commonwealth Law. Aside from crops, they can also be harmful to wooden structures and ornamental trees as they chew and rip at timber on houses and tree limbs.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Sulphur-crested cockatoos are popular pets and companion birds. Their yellow feathers have been used in ceremonial headdresses.

Positive Impacts: pet trade ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Sulphur-crested Cockatoo

The Sulphur-crested Cockatoo (Cacatua galerita) is a relatively large white cockatoo found in wooded habitats in Australia and New Guinea. They can be locally very numerous, leading to them sometimes being considered pests. They are well known in aviculture, although they can be demanding pets.

Contents

Distribution

In Australia, Sulphur-crested Cockatoos can be found widely in the north and east, ranging as far south as Tasmania, but avoiding arid inland areas with few trees. They are numerous in suburban habitats in cities such as Adelaide, Melbourne, Canberra, Sydney and Brisbane. Except for highland areas, they occur throughout most of New Guinea and on nearby smaller islands such as Waigeo, Misool and Aru, and various islands in the Cenderawasih Bay and Milne Bay.

There are four recognised subspecies;

  1. C. g. triton (Temminck, 1849) is found in New Guinea and the surrounding islands,
  2. C. g. elenora (Finsch, 1867) is restricted to the Aru Islands between Australia and New Guinea,
  3. C. g. fitzroyi (Mathews, 1912) in northern Australia from West Australia to the Gulf of Carpentaria
  4. and the nominate subspecies C. g. galerita which is found from Cape York to Tasmania.[2]

Introduced species

Within Australia, Sulphur-crested Cockatoos of the nominate race have also been introduced to Perth, which is far outside the natural range. Outside Australia, they have been introduced to Singapore, where their numbers have been estimated to be between 500 and 2000. They have also been introduced to Palau and New Zealand. In New Zealand the introduced populations may number less than 1000. This species has also been recorded as established in Hawaii and from various islands in Wallacea (e.g. Kai Islands and Ambon), but it is unclear if it has managed to become established there.

Description

In Brisbane, Queensland.

It has a total length of 44–55 cm (17–22 in), with the Australian subspecies larger than subspecies from New Guinea and nearby islands. The plumage is overall white, while the underwing and -tail are tinged yellow. The expressive crest is yellow. The bill is black, the legs are grey, and the eye-ring is whitish. Males typically have almost black eyes, whereas the females have a more red or brown eye, but this require optimum viewing conditions to be seen. The differences between the subspecies are subtle. C. g. fitzroyi is similar to the nominate race but lacks the yellow on the ear tufts and slightly blueish skin around the eye. C. g. eleonora is similar to C. g. fitzroyi but is smaller and has broader feathers in the crest, and C. g. triton is similar to C. g. eleonora except it has a smaller bill.[2]

It is similar in appearance to the three species of corellas found in Australia. However, corellas are smaller, lack the prominent yellow crest and have pale bills. In captivity, the Sulphur-crested Cockatoo is easily confused with the smaller Yellow-crested Cockatoo or the Blue-eyed Cockatoo with a differently shaped crest and a darker blue eye-ring.

Behaviour

Walking on grass in Tasmania, Australia
Perched in a tree in Victoria, Australia

Their distinctive raucous call can be very loud; it is adapted to travel through the forest environments in which they live, including tropical and subtropical rainforests. These birds are naturally curious, as well as very intelligent. They have adapted very well to European settlement in Australia and live in many urban areas.

These birds are very long-lived, and can live upwards of 70 years in captivity,[3][4] although they only live to about 20–40 years in the wild. They have been known to engage in geophagy, the process of eating clay to detoxify their food. These birds produce a very fine powder to waterproof themselves instead of oil as many other creatures do.

The Sulphur-crested Cockatoo is a seasonal breeder in Australia, little is known about its breeding behaviour in New Guinea. In southern Australia the breeding season is from August to January, whereas in northern Australia the season is from May to September.[2] The nest is a bed of wood chips in a hollow in a tree. Like many other parrots it competes with others of its species and with other species on nesting sites.[5] Two to three eggs are laid and incubation lasts between 25–27 days. Both parents incubate the eggs and raise the nestlings. The nestling period is between 9 to 12 weeks, and the young fledgelings remain with their parents for a number of months after fledging.[2]

A 2009 study involving an Eleonora Cockatoo (the subspecies Cacatua galerita eleonora) named Snowball found that Sulphur-crested Cockatoos are capable of synchronising movements to a musical beat.[6][7]

Species that feed on the ground are very vulnerable to predator attack. The Cockatoo has evolved a behavioural adaptation to protect against this: whenever there is a flock on the ground, there is at least one high up in a tree (usually a dead tree), keeping guard. This is so well known that it has even entered Australian slang: a person keeping guard for sudden police raids on illegal gambling gatherings is referred to as a Cockatoo or Cocky for short.

Pest status

Numerous cockatoos causing damage to a shopping centre facade

In some parts of Australia, the Sulphur-crested Cockatoo can be very numerous, and may cause damage to cereal and fruit crops, newly planted tree seedling, and soft timber on houses and outdoor furniture.[8] Consequently, they are sometimes shot or poisoned as pests. Government permit is required, as they are a protected species under the Australian Commonwealth Law.

Aviculture

Sulphur-crested Cockatoos may no longer be imported into the United States as a result of the Wild Bird Conservation Act (WBCA).[9] However, they have been bred in captivity. They are demanding pets, being very loud and having a natural desire to chew wood and other hard and organic materials.

Cocky Bennett of Tom Ugly's Point in Sydney was a celebrated Sulphur-crested Cockatoo who reached an age of 100 years or more. He had lost his feathers and was naked for much of his life, and died in the early years of the twentieth century. His body was stuffed and preserved after death.[10] Another 'Cocky', born in 1921 and residing in Arncliffe with his owner Charlie Knighton, was 76 years old in the late 1990s.[11]

Sulphur-crested Cockatoos, along with many other parrots, are susceptible to Psittacine Beak and Feather Disease, a viral disease, which causes birds to lose their feathers and grow grotesquely shaped beaks. The disease occurs naturally in the wild,[12] and in captivity.[13]

References

Citations
  1. ^ BirdLife International (2012). "Cacatua galerita". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106001399. Retrieved 16 July 2012.
  2. ^ a b c d Rowley 1997, p.p.246–269.
  3. ^ http://www.burkesbackyard.com.au/factsheets/Birds/Australias-Oldest-Cocky:-Qantas-Amazing-Australia/2161
  4. ^ http://www.smh.com.au/environment/animals/sydneys-old-crock-of-a-cockie-was-a-legend-at-120-20110831-1jkz2.html
  5. ^ Heinsohn, Robert; Stephen Murphy and Sarah Legge. "Overlap and competition for nest holes among eclectus parrots, palm cockatoos and sulphur-crested cockatoos". Australian Journal of Zoology 51 (1): 81–94. doi:10.1071/ZO02003. 
  6. ^ Patel, Aniruddh D.; Iversen, JR; Bregman, MR; Schulz, I (2009-04-30). "Experimental Evidence for Synchronization to a Musical Beat in a Nonhuman Animal". Current Biology 19 (10): 827–30. doi:10.1016/j.cub.2009.03.038. PMID 19409790. 
  7. ^ Cockatoo Dances to the Beat on YouTube
  8. ^ Dept of Primary Industries Victoria. 2011. "Reducing cockatoo damage to trees, fixtures, houses, sports grounds and the environment" Retrieved on 29 Dec 2012.
  9. ^ "Wild Bird Conservation Act". US Fish and Wildlife Service. http://www.fws.gov/international/DMA_DSA/Permits/web_list_wbca.html. Retrieved 2012-12-27.
  10. ^ Lendon, p. xxvi
  11. ^ "Australia's Oldest Cocky: Qantas Amazing Australia". Burkes Backyard website. CTC Productions. 2006. http://www.burkesbackyard.com.au/factsheets/Birds/Australias-Oldest-Cocky:-Qantas-Amazing-Australia/2161. Retrieved 2009-11-14.
  12. ^ Raidal, S.; McElnea, C.; Cross, G. (1993). "Seroprevalence of psittacine beak and feather disease in wild psittacine birds in New South Wales". Australian Veterinary Journal 70 (4): 137–139. doi:10.1111/j.1751-0813.1993.tb06105.x. PMID 8494522. 
  13. ^ Kiatipattanasakul-Banlunara, W; Tantileartcharoen R; Katayama K; Suzuki K; Lekdumrogsak T; Nakayama H; Doi K (2002). "Psittacine beak and feather disease in three captive sulphur-crested cockatoos (Cacatua galerita) in Thailand". Journal of Veterinary Medical Science 64 (6): 527–529. doi:10.1292/jvms.64.527. PMID 12130840. 
Bibliography
  • Lendon, Alan H. (1973). Australian Parrots in Field and Aviary (2nd. ed). Sydney: Angus and Robertson. ISBN 0-207-12424-8. 
  • Rowley, Ian (1997). "Family Cacatuidae (Cockatoos)". In Josep, del Hoyo; Andrew, Elliott; Jordi, Sargatal. Handbook of the Birds of the World. Volume 4, Sandgrouse to Cuckoos. Barcelona: Lynx Edicions. ISBN [[Special:BookSources/84873334229|84873334229 [[Category:Articles with invalid ISBNs]]]]. 

Further reading

  • Flegg, Jim (2002). Birds of Australia: Photographic Field Guide. Sydney: Reed New Holland. ISBN 1-876334-78-9. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!