Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Distribution

Range

Breeds Europe and Russia; winters in tropical Africa.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.887 - 10.887
  Nitrate (umol/L): 6.523 - 6.523
  Salinity (PPS): 35.253 - 35.253
  Oxygen (ml/l): 6.189 - 6.189
  Phosphate (umol/l): 0.479 - 0.479
  Silicate (umol/l): 2.463 - 2.463
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Phylloscopus sibilatrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Barcode data: Phylloscopus sibilatrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACCCTCTACCTAATCTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCCGGCGCACTCCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACTGCCCACGCCTTCGTAATAATCTTCTTCATAGTTATACCCATCATGATCGGAGGCTTCGGAAACTGACTAGTCCCACTAATAATCGGAGCCCCAGACATGGCATTCCCCCGAATAAACAACATAAGCTTTTGACTACTCCCCCCATCCTTCCTCCTGCTACTAGCCTCTTCTACCGTAGAGGCAGGGGTAGGAACGGGCTGAACAGTATACCCCCCTCTAGCTGGCAACCTGGCACACGCCGGAGCCTCCGTCGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTATCTCTTCTATCCTAGGGGCTATCAACTTCATCACAACCGCAATTAACATAAAACCACCTGCCCTATCACAATATCAAACCCCCCTATTCGTCTGATCAGTACTAATCACCGCAGTTCTGCTACTCCTTTCCCTCCCAGTCCTTGCCGCTGGAATTACCATGCTACTCACAGACCGCAACCTCAACACCACCTTCTTCGACCCTGCAGGCGGAGGAGATCCAGTTCTTTATCAACATCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTGCCAGGATTTGGAATTAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status in Egypt

Regular passage visitor.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 14,000,000-22,000,000 breeding pairs, equating to 42,000,000-66,000,000 individuals (BirdLife International 2004). Europe forms 75-94% of the global range, so a very preliminary estimate of the global population size is 44,700,000-88,000,000 individuals, although further validation of this estimate is needed.

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Wood warbler

This article is about the Eurasian leaf warbler. For American wood warblers, see New World warbler.

The wood warbler (Phylloscopus sibilatrix) is a common and widespread leaf warbler which breeds throughout northern and temperate Europe, and just into the extreme west of Asia in the southern Ural Mountains. This warbler is strongly migratory and the entire population winters in tropical Africa.

Habitat[edit]

This is a bird of open but shady mature woodlands, such as beech and sessile oak, with some sparse ground cover for nesting. The dome-shaped nest is built near the ground in low shrub. 6 or 7 eggs are laid in May; there may be a second brood. Like most Old World warblers, this small passerine is insectivorous.

Description[edit]

The wood warbler is 11–12.5 cm long, and a typical leaf warbler in appearance, green above and white below with a lemon-yellow breast. It can be distinguished from similar species, like the chiffchaff P. collybita and the willow warbler, P. trochilus by its yellow supercilium, throat and upper breast, pale tertial edges, longer primary projection, and by its shorter but broader tail.

It is a summer visitor to the United Kingdom, seen from April until August. It has declined there in recent years; it is now very rare in Ireland.

Songs[edit]

It has two song types, often (but not always) given alternately; a high-pitched fluid metallic trill of increasing tempo About this sound pit-pit-pitpitpitpt-t-t-ttt  lasting 2–3 seconds, and a series of 3 to 5 descending piping notes of lower pitch piüü-piüü-piüü. The contact call is a soft piping note, similar to the second song type, but shorter and given singly, "piü".

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!