Articles on this page are available in 1 other language: Chinese (Simplified) (11) (learn more)

Overview

Distribution

Range Description

There is evidence to suggest that the European population (200,000-510,000 pairs, occupying 50-74% of the global breeding range) has declined by up to 30% over ten years (three generations), but this may reflect shifts in breeding populations, populations in Asia are not thought to be declining and wintering populations in Africa appear to be increasing.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Breeds Europe and Russia; winters in tropical Africa.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.887 - 10.887
  Nitrate (umol/L): 6.523 - 6.523
  Salinity (PPS): 35.253 - 35.253
  Oxygen (ml/l): 6.189 - 6.189
  Phosphate (umol/l): 0.479 - 0.479
  Silicate (umol/l): 2.463 - 2.463
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.
All rights reserved

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Depth range based on 1 specimen in 1 taxon.
Water temperature and chemistry ranges based on 1 sample.

Environmental ranges
  Depth range (m): 0 - 0
  Temperature range (°C): 10.887 - 10.887
  Nitrate (umol/L): 6.523 - 6.523
  Salinity (PPS): 35.253 - 35.253
  Oxygen (ml/l): 6.189 - 6.189
  Phosphate (umol/l): 0.479 - 0.479
  Silicate (umol/l): 2.463 - 2.463
 
Note: this information has not been validated. Check this *note*. Your feedback is most welcome.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.2 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Phylloscopus sibilatrix

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCACAAAGACATTGGCACCCTCTACCTAATCTTTGGCGCATGAGCTGGAATAGTAGGCACCGCCCTAAGCCTCCTTATCCGAGCAGAACTAGGCCAACCCGGCGCACTCCTAGGAGACGACCAAGTTTACAACGTAGTCGTCACTGCCCACGCCTTCGTAATAATCTTCTTCATAGTTATACCCATCATGATCGGAGGCTTCGGAAACTGACTAGTCCCACTAATAATCGGAGCCCCAGACATGGCATTCCCCCGAATAAACAACATAAGCTTTTGACTACTCCCCCCATCCTTCCTCCTGCTACTAGCCTCTTCTACCGTAGAGGCAGGGGTAGGAACGGGCTGAACAGTATACCCCCCTCTAGCTGGCAACCTGGCACACGCCGGAGCCTCCGTCGACCTGGCTATCTTCTCCCTCCACCTAGCAGGTATCTCTTCTATCCTAGGGGCTATCAACTTCATCACAACCGCAATTAACATAAAACCACCTGCCCTATCACAATATCAAACCCCCCTATTCGTCTGATCAGTACTAATCACCGCAGTTCTGCTACTCCTTTCCCTCCCAGTCCTTGCCGCTGGAATTACCATGCTACTCACAGACCGCAACCTCAACACCACCTTCTTCGACCCTGCAGGCGGAGGAGATCCAGTTCTTTATCAACATCTATTCTGATTCTTCGGTCACCCAGAAGTCTACATCCTAATCCTGCCAGGATTTGGAATTAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Phylloscopus sibilatrix

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2015

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (extent of occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2012
    Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5