Overview

Brief Summary

The Yellow-crowned Amazon (Amazona ochrocephala) complex includes several forms that are regarded as subspecies by some authorities and as full species by others. Juniper and Parr (1998) recognized three distinct species: the Yellow-crowned Amazon (A. ochrocephala), the Yellow-headed Amazon (A. oratrix), and the Yellow-naped Amazon (A. auropalliata). However, they noted that the status of these taxa was unresolved and that, for example, the presence of forms intermediate between the Yellow-headed Amazon and Yellow-naped Amazon suggests that they might better be treated as belonging to a single species. They also pointed out that clarifying the situation is made more complex by possibly age-related plumage variation and substantial individual variation within currently recognized subspecies. Although Juniper and Parr provisionally recognized three distinct species, for similar reasons Collar (1997) and others have provisionally treated the various forms as members of a single highly variable species. Subsequent molecular phylogenetic studies have revealed even more taxonomic complexity. Investigations by Eberhard and Bermingham (2004) and Russello and Amato (2004) indicated that the Blue-fronted Amazon (A. aestiva) may in fact be nested within the Yellow-Crowned complex (Russello and Amato concluded that the Yellow-shouldered Amazon, A. barbadensis, also falls within this group). Further sampling and analysis by Ribas et al. (2007) provided additional evidence indicating that actual evolutionary relationships among genetic lineages in this group may not be well reflected by the plumage variations by which the traditional taxa are defined (see below). (Ribas et al. and references therein should be consulted for more details.)

As traditionally defined, "Yellow-crowned Amazons" are mainly green with yellow feathers on the forehead and forecrown, sometimes extending onto the lores (the area between the bill and the eyes) and around the eyes. and often with a red spot at the base of the upper mandible (birds in the western Amazon basin have a green forehead). "Yellow-headed Amazons" are similar in appearance but have yellow extending over the entire head (immatures are largely green with little or no yellow on the head and little or no red and yellow on the wing). "Yellow-naped Amazons" have yellow limited to the nape and, sometimes, the forehead and forecrown.

Yellow-crowned Amazons move quietly in the treetops and fly well above the canopy with rapid, shallow wingbeats. They are found in tropical deciduous woodland, tall thorn scrub, humid gallery forest, seasonally flooded forest and secondary riverine growth, mangroves, pine savanna, Maurita palm stands in wetter open areas, cultivated land with remnant groves of trees, and even some suburban areas. They occur mostly in lowlands below 500 m. Nests are in tree cavities at 6 to 15 m.  The "Yellow-headed Amazon" is endangered, although some of the other forms are locally quite common (e.g., "Yellow-crowned Amazon" in parts of Peru and Brazil).

"Yellow-headed Amazons" are confined to Middle America in Mexico, Belize, extreme eastern Guatemala, and extreme northwestern Honduras. Feral populations are established in Miami (Florida, U.S.A.) and Puerto Rico. These birds are local and uncommon throughout most of their range, with populations severely depleted by habitat loss and trapping for the pet trade both within and outside the native range. "Yellow-naped Amazons" occur in Middle America in the eastern Pacific lowlands of Mexico, Guatemala (possibly), El Salvador (lower arid tropical zone), Honduras, and Nicaragua to northwestern Costa Rica (from the southern end of the Gulf of Nicoya northward). The "Yellow-crowned Amazon" is found in Panama (and possibly Honduras) in Middle America and in South America south to eastern Brazil and northern Bolivia (it is rare in Trinidad).

(Collar 1997 and references therein; Juniper and Parr 1998 and references therein)

  • Collar, N.J. 1997. Yellow-crowned Amazon (Amazona ochrocephala). Pp. 473-474 in: del Hoyo, J., Elliott, A., and Sargatal, J., eds. Handbook of the Birds of the World. Volume 4. Sandgrouse to Cuckoos. Lynx Edicions, Barcelona.
  • Eberhard, J.R. and E. Bermingham. 2004. Phylogeny and biogeography of the Amazona ochrocephala (Aves: Psittacidae) complex. Auk 121: 318–332.
  • Juniper, T. and M. Parr. 1998. Parrots: A Guide to Parrots of the World. Yale University Press, New Haven, Connecticut.
  • Ribas, C.C., E.S. Tavares, C. Yoshihara, and C.Y. Miyaki. 2007. Phylogeny and biogeography of Yellow-headed and Blue-fronted Parrots (Amazona ochrocephala and Amazona aestiva) with special reference to the South American taxa. Ibis 149: 564-574.
  • Russello, M.A. and G. Amato. 2004. A molecular phylogeny of Amazona: implications for Neotropical parrot biogeography, taxonomy, and conservation. Molecular Phylogenetics and Evolution 30: 421-437.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Global Range: RESIDENT: Northern Honduras (possibly introduced); Panama; northwestern, northern, and eastern Colombia, Venezuela (except Andean region), and Guianas, south and east of the Andes, to eastern Ecuador, eastern Peru, northern Bolivia, and Amazonian northern Brazil (see Sibley and Monroe 1990 for further details). Introduced in Puerto Rico (small numbers in various locations along north coast) and southern California.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

Geographic Range

Amazona ochrocephala is found from central Mexico to central South America, including to the southern Amazonian Basin east to Peru, and including Trinidad and other Carribean Islands. They have been introduced to southern California and south Florida.

Biogeographic Regions: nearctic (Introduced ); neotropical (Native )

  • Perrins, C. 1990. The Illustrated Encyclopedia of Birds- the definitive reference to birds of the world. New York, NY: Prentice Hall.
  • Decoteau, A. 1983. The Handbook of Amazon Parrots. Neptune City, NJ: TFH Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Exotic

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Yellow-crowned parrots have a mass of 402 to 561 g and are usually around 35 cm in length. They generally have bright green feathers edged in black with yellow markings on the head and face. Yellow-crowned parrots have yellow feathers directly above the beak. The cere and hairs around the nostrils are black. The beak is usually dark gray to black. The tail is short (about 10.16 cm) and squared-off at the base. Males and females are similar.

Range mass: 405 to 561 g.

Average length: 35 cm.

Range wingspan: 20.3 to 21.6 cm.

Sexual Dimorphism: sexes alike

  • Freud, A. 1995. The Complete Parrot. New York, NY: Macmillan.
  • Davis, L. 1972. A Field Guide to the Birds of Mexico & Central America. Austin, TX: University of Texas Press.
  • Ridgely, R. 1976. A Guide to the Birds of Panama. Princeton, NJ: Princeton University Press.
  • Avian Web. 2006. "Avian Web" (On-line). Yellow-crowned or Yellow-fronted or Yellow-headed Amazon. Accessed October 14, 2006 at http://www.avianweb.com/yellowcrownedamazon.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 35 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-crowned parrots are found in a variety of habitats ranging from humid lowlands and tropical forests to deciduous woodlands and tall scrubland. They can also be found in pine forests and agricultural areas.

Range elevation: 0 to 900 m.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: forest ; rainforest ; scrub forest

Other Habitat Features: agricultural

  • Grzimek, B. 2003. Grzimek's Animal LIfe Encyclopedia. Farmington Hills, MI: Gale.
  • Rodner, C., M. Lentino, R. Restrall. 2000. Checklist of the Birds of Northern South America. New Haven, CT: Yale Univeristy Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: ALL SEASONS: Forest, woodland, savanna, farmlands (Sibley and Monroe 1990). BREEDING: In Puerto Rico, known to nest in a hollow royal palm on the golf course of the Dorado Beach Hotel (Raffaele 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Yellow-crowned parrots are opportunistic feeders and gather in treetops in parties of around ten to feed. They eat seeds, nuts, fruits, berries, blossoms and leaf buds. They use their feet to manipulate food and extract nut kernels with their beak and tongue. Yellow-crowned parrots are fond of maize and cultivated fruits.

Plant Foods: seeds, grains, and nuts; fruit; flowers

Primary Diet: herbivore (Frugivore , Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Yellow-crowned parrots eat seeds, nuts, fruits, and berries, and are important seed predators and seed dispersers.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Yellow-crowned parrots do not have many predators as adults. Natural predation on yellow-crowned parrots is primarily from boa constrictors (Boa constrictor), accounting for a 9.5% decrease in breeding success each year. Boa constrictors feed on fledgings and females found in or around the nest. Poaching by humans is the primary cause of breeding failure. Because of combined predation by snakes and poaching by humans, yellow-crowned parrots have very low breeding success (10-14%).

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Yellow-crowned parrots give off a variety of metallic shrieks, whistles, squawks, and repeated screeches. Like other parrots, they have a complex and flexible repertoire, giving them the ability to mimic human speech. They also use visual perception for courtship displays.

Communication Channels: visual ; acoustic

Other Communication Modes: mimicry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Yellow-crowned parrots, like most large parrots, have a very long lifespan. Little is known about the lifespan of yellow-crowned parrots in the wild. In captivity large parrots can live for up to 100 years.

Range lifespan

Status: wild:
56 (high) years.

Average lifespan

Status: captivity:
56 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 56 years (captivity) Observations: One specimen lived for 56 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Yellow-crowned parrots are monogamous birds. They have simple courtship displays for attracting mates that include bowing, wing-drooping, wing-flicking, tail-wagging, foot-raising, and dilation of the eye pupils. When roosting, pairs remain close together.

Mating System: monogamous

The breeding period for yellow-crowned parrots is December through May. In this time, they lay clutch sizes of 2 to 4 eggs, laying only one clutch per season. It takes about 25 days for the eggs to hatch and about 56 days for them to become fledglings. Offspring become independent about 2 months after they hatch. Both male and female yellow-crowned parrots reach sexual maturity at about 3 years.

Breeding interval: Yellow-crowned parrots breed once yearly.

Breeding season: Breeding occurs from December through May.

Range eggs per season: 2 to 4.

Range time to hatching: 24 to 27 days.

Average time to hatching: 25 days.

Average fledging age: 56 days.

Average time to independence: 2 months.

Range age at sexual or reproductive maturity (female): 2 to 4 years.

Range age at sexual or reproductive maturity (male): 2 to 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Up to one month before the first egg is layed, female A. ochrocephala prepare a nest in a tree hollow. The female lays a clutch of 2 to 4 eggs (at 2 day intervals) which she incubates for 24 to 27 days. The eggs are plain white with no shell markings and have an elliptical shape. During this time, the male remains close to the nest entrance and feeds the female. After hatching, the female remains with the young for most of the day, occasionally taking breaks to forage. A few days after the eggs hatch, the male begins to enter the nest cavity to feed the young, although the female still does the majority of the feeding.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Grzimek, B. 2003. Grzimek's Animal LIfe Encyclopedia. Farmington Hills, MI: Gale.
  • Sibley, D., C. Elphick, J. Dunning. 2001. National Adubon Society: The Sibley Guide to Bird Life and Behavior. New York, NY: Chanticleer Press, Inc..
  • Forshaw, J., D. Kirshner. 1998. Encyclopedia of Birds. San Diego, CA: Academic Press.
  • Walters, M. 1994. Eyewitness Handbooks Birds' Eggs. New York, NY: Dorling Kindersley.
  • Rodriguez Castillo, A., J. Eberhard. 2006. Reporductive Behavior of the Yellow-Crowned Parrot (Amazona Ochrocephala) in Western Panama. The Wilson Journal of Ornithology, 188/2: 225-236. Accessed October 13, 2006 at http://0-www.bioone.org.ariadne.kzoo.edu:80/perlserv/?request=get-document&doi=10.1676%2F05-003.1.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Nesting has been observed February to June in Puerto Rico (Raffaele 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amazona ochrocephala

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTACCTAATTTTCGGCGCATGAGCTGGCATAATTGGCACCGCCCTAAGTCTACTCATTCGCGCAGAGCTTGGCCAACCAGGAACCCTCCTTGGAGACGACCAAATCTACAACGTAATCGTCACGGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGAGGGTTCGGAAACTGGCTAGTCCCCCTCATAATTGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTTCTATTAGCCTCCTCCACAGTAGAAGCAGGAGCGGGCACAGGATGAACAGTCTACCCCCCCCTAGCCGGCAACCTAGCTCACGCCGGAGCCTCAGTAGACCTAGCTATTTTCTCCCTCCACCTGGCTGGTGTATCCTCCATCCTAGGGGCAATCAACTTCATCACTACAGCCATCAACATAAAACCACCCGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCCGTCCTAATCACAGCCGTACTACTACTACTAGCACTACCAGTCCTAGCTGCTGGAATTACCATACTCCTCACAGATCGTAACCTAAACACAACATTCTTCGACCCTGCTGGGGGAGGAGACCCAATCCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amazona ochrocephala

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 32
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Yellow-crowned parrots have a "least concern" rating on the IUCN Red List. However, along with most other parrots, they have a CITES Appendix I status.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix i

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: NNA - Not Applicable

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G4 - Apparently Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as common in at least parts of its range (del Hoyo et al. 1997).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Their love of cultivated fruits makes yellow-crowned parrots pests to orchard and farm owners in their range. They cause damage to maize and fruit crops.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Yellow-crowned parrots have an uncanny ability to mimic human speech. Because of this ability they are popular as pets. Feathers are sometimes used in native decoration and Amazon parrots in general are popular with birders, encouraging ecotourism in their native ranges.

Positive Impacts: pet trade ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Yellow-crowned Amazon

The Yellow-crowned Amazon or Yellow-crowned Parrot (Amazona ochrocephala), is a species of parrot, native to the tropical South America and Panama. The taxonomy is highly complex, and the Yellow-headed (A. oratrix) and Yellow-naped Amazon (A. auropalliata) are sometimes considered subspecies of the Yellow-crowned Amazon. Except in the taxonomic section, the following deals only with the nominate group (including subspecies xantholaema, nattereri and panamensis).

Description[edit]

Pet parrot

Subspecies in the nominate group (including subspecies xantholaema, nattereri and panamensis) have a total length of 33–38 cm (13–15 in). As most other Amazon parrots, it has a short squarish tail and a primarily green plumage. It has dark blue tips to the secondaries and primaries, and a red wing speculum, carpal edge (leading edge of the wing at the "shoulder") and base of the outer tail-feathers.[2] The red and dark blue sections are often difficult to see when the bird is perched, while the red base of the outer tail-feathers only infrequently can be seen under normal viewing conditions in the wild.[3] The amount of yellow to the head varies, with nominate, nattereri and panamensis having yellow restricted to the crown-region (occasionally with a few random feathers around the eyes[3] ), while the subspecies xantholaema has most of the head yellow.[2] All have a white eye-ring. They have a dark bill with a large horn or reddish spot on the upper mandible except panamensis, which has a horn coloured beak. Males and females do not differ in plumage. Except for the wing speculum, juveniles have little yellow and red to the plumage.[2]

Habitat and distribution[edit]

The Yellow-headed Parrot is found in the Amazon Basin and Guianas, with additional populations in north-western South America and Panama. It is a bird of tropical forest (both humid and dry), woodland, mangroves, savanna and may also be found on cultivated land and suburban areas. In the southern part of its range, it is rarely found far from the Amazon Rainforest. It is mainly a lowland bird, but has locally been recorded up to 800 m (2600 ft) along on the eastern slopes of the Andes.[4]

Behaviour[edit]

Food and feeding[edit]

They are normally found in pairs or small flocks up to 30, but larger groups may gather at clay licks. Their food includes fruits, nuts, seeds and berries.[5] Foods with sugar and a large amount of salt can be dangerous for them.

Breeding[edit]

The nest is in a hollow in a tree, palm or termitarium, where they lay two to three eggs.[2] The incubation time is about 26 days, and the chicks leave the nest about 60 days from hatching.[5][6]

Taxonomy[edit]

A. o. ochrocephala

The Amazona ochrocephala complex, which has been described as "a taxonomic headache",[7] is considered a single species by some authorities and split into three species, A. ochrocephala (Yellow-crowned Amazon), A. auropalliata (Yellow-naped Amazon) and A. oratrix (Yellow-headed Amazon), by others. The split is mainly based on the amount of yellow in the plumage, the colour of the legs and bill, the close proximity of the oratrix group and auropalliata group in Oaxaca, Mexico, without apparent interbreeding,[8] and the presence of members of both the nominate group and the auropalliata group in northern Honduras.[9] This evaluation has, however, been confused by misunderstandings regarding the plumage variations in the populations in northern Honduras, where birds vary greatly in amount of yellow on the head, crown and nape, but have pale bills and a juvenile plumage matching the oratrix group, but neither the nominate nor the auropalliata group.[7][10] The taxon caribaea from the Bay Islands is a member of the auropalliata group, and occurs in relatively close proximity to the members of the oratrix group. As caribaea may have a relatively pale lower mandible, this could indicating a level of gene flow between this and the nearby taxa of the oratrix group.[11] If confirmed, this could suggest that the two are better considered conspecific. Alternatively, it has been suggested that caribaea and parvipes, both typically placed in the auropalliata group, may be closer to the oratrix than they are to the auropalliata sensu stricto. Both are relatively small and have red to the shoulder as in the members of the oratrix group, but unlike auropalliata sensu stricto.[7][10]

The members of this complex are known to hybridize in captivity,[7] and recent phylogenetic analysis of DNA did not support the split into the three "traditional" biological species, but did reveal three clades, which potentially could be split into three phylogenetic species: A Mexican and Central American species (incl. panamensis, which extends slightly into South America), a species of northern South America (northern nominate), and a species from the southern Amazon Basin (nattereri, xantholaema and southern nominate).[12] The Central American clade can potentially be split further, with panamensis and tresmariae recognized as two monotypic species. The members of the clade from the southern Amazon Basin should arguably be included as subspecies of the Blue-fronted Amazon, as they are closer to each other than to the northern clades.[12][13][14] Disregarding these problems, the following taxa are part of the Amazona ochrocephala complex as traditionally delimited:[2]

Of these, hondurensis was only recently described,[15] while the population in north-western Honduras and adjacent eastern Guatemala (near Puerto Barrios) resembles belizensis and commonly is included in that subspecies, but may actually represent an undescribed subspecies. It has sometimes been referred to as guatemalensis,[2] but until officially described, the name remains provisional. An additional subspecies, magna, has sometimes been recognized for the population on the Gulf slope of Mexico, but today most authorities consider it invalid, instead including this population in oratrix.[5][7][16]

Conservation[edit]

The Yellow-crowned Amazon is considered to be of least concern by BirdLife International, and, consequently, also by IUCN. Although populations are believed to be in decline they do not yet approach the threshold specified by BirdLife International to rate the species as Near Threatened. As is the case with most parrots, it is listed on appendix II of CITES.[17] It occurs in numerous protected areas, and remains fairly common throughout a large part of its range.[3][4]

References[edit]

  1. ^ BirdLife International (2012). "Amazona ochrocephala". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c d e f Juniper, T., & M. Parr. 1998. A Guide to the Parrots of the World. Pica Press, East Sussex. ISBN 1-873403-40-2
  3. ^ a b c Steven Hilty (2003). Birds of Venezuela, 2nd edition. Princeton University Press. ISBN 0-691-02131-7. 
  4. ^ a b Schulenberg, T., D. Stotz, D. Lane, J. O'Neill, & T. Parker III. 2007. Birds of Peru. Princeton University Press. ISBN 978-0-7136-8673-9
  5. ^ a b c d Collar, N. 1997. Amazona ochrocephala (Yellow-crowned Parrot). Pp 473-474 in: del Hoyo, J., A. Elliott & J. Sargatal. Eds. 1997. Handbook of the Birds of the World. Vol. 4. Sangrouse to Cuckoos. Lynx Edicions, Barcelona. ISBN 84-87334-22-9
  6. ^ Alderton, David (2003). The Ultimate Encyclopedia of Caged and Aviary Birds. London, England: Hermes House. p. 231. ISBN 1-84309-164-X. 
  7. ^ a b c d e Steve N. G. Howell and Sophie Webb (1995). A Guide to the Birds of Mexico and Northern Central America. Oxford University Press. ISBN 0-19-854012-4. 
  8. ^ Binford, L. (1989). A distributional survey of the birds of the Mexican state of Oaxaca. Ornithological Monographs. 43: 1–418.
  9. ^ Monroe, B., Monroe, JR. & T. Howell. (1966). Geographic variation in Middle American parrots of the Amazona ochrocephala complex. Occasional Papers of the Museum of Zoology, no. 34. Louisiana State University, Baton Rouge.
  10. ^ a b Lousada, S., & S. Howell. 1996. Distribution, variation, and conservation of Yellow-headed Parrots in northern Central America. Cotinga 5: 46-53.
  11. ^ Lousada, S. 1989. Amazona auropalliata caribaea: A new subspecies of parrot from the Bay Islands, northern Honduras. Bull. BOC 109: 232-235.
  12. ^ a b Eberhard, J., & E. Bermingham. 2004. Phylogeny and Biogeography of the Amazona ochrocephala (Aves: Psittacidae) Complex. Auk 121(2): 318-332
  13. ^ Russello, M. A., & Amato, G. (2004). A molecular phylogeny of Amazona: implications for Neotropical parrot biogeography, taxonomy, and conservation. Molecular Phylogenetics and Evolution. 30(2): 421-437
  14. ^ Ribas, C. C., Tavares, E. S., Yoshihara, C., & Miyaki C. Y. (2007). Phylogeny and biogeography of yellow-headed and blue-fronted parrots (Amazona ochrocephala and Amazona aestiva) with special reference to the South American taxa. Ibis 149: 564-574
  15. ^ Lousada, S., & S. Howell. 1997. Amazona oratrix hondurensis: A new subspecies of parrot from the Sula Valley of northern Honduras. Bull. BOC 117: 203-223.
  16. ^ Clements, J. 2007. The Clements Checklist of the Birds of the World. Christopher Helm. ISBN 978-0-7136-8695-1
  17. ^ CITES listings. Retrieved on 2 February 2008
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Often has been regarded as conspecific with A. oratrix and A. auropalliata, but lack of evidence of interbreeding in areas of near or actual overlap in Oaxaca and Honduras suggests allospecies treatment (Sibley and Monroe 1990).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!