Overview

Distribution

Geographic Range

The Red-Lored Parrot is found in North, Central and South America, particularly from eastern Mexico thorugh western Ecuador. Most Red-Lored Parrots are found in Panama. One subspecies, A. a. diadema, is restricted to northwestern Brazil and occurs only between the Upper Amazon and Negro Rivers. They live in the canopy of tropical rainforests. (Forshaw 1977, Hogle Zoo 1999)

Biogeographic Regions: nearctic (Native ); neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Like all parrots, red-lored amazons have a large head and a short neck. This parrot is about 34 centimeters long. The feathers are mostly green, but the forehead and lores are red, hence the name, red-lored parrot. The red area on its forehead is very hard to see making this species of parrot hard to identify. Because of this they are often confused with other species of Amazona. Feathers on the top and back of the head are tipped in lilac-blue. The wing feathers often also bear bright red, yellow, black, and white hightlights. The upper cheeks are yellow and the largest wing feathers are also often mostly yellow. They have short wings, but can fly powerfully. The tail is green, square, and tipped with yellowish green and blue. The countour feathers are sparse, hard and glossy with powderdown in between them. The bill is grey with a yellowish horn on the upper mandible. Above the upper bill they have a fleshy, often feathered projection called a cere. The iris of its eye is orange. Its legs are greenish grey. Sexes are monomorphic. Like all parrots, this parrot has very strong zygodactyl feet.

Average length: 34 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • 2000. Encyclopedia Americana. New York, NY: Groiler Incorporated.
  • Campbell, B., E. Lack. 1985. A Dictionary of Birds. Philidelphia, PA: Buteo Books.
  • Forshaw, J. 1977. Parrots of the World. Neptune, NJ: T.F.H. Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

These parrots are arboreal and live primarily in rainforests. They prefer to live in wild areas.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

  • Brooke, M., T. Birkhead. 1991. The Cambridge Encyclopedia of Ornithology. Cambridge, MA: Cambridge University Press.
  • Ridgely, R. 1981. A Guide to the Birds of Panama. Princeton, NJ: Princeton University Press.
  • Utah's Hogle Zoo, 1999. "Red-Lored Amazon Parrot" (On-line). Accessed March 12, 2001 at http://www.hoglezoo.org/birds/redlored.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The Red-Lored Parrot is vegetarian. It enjoys eating seeds, fruit, nuts, berries, greens, blossoms and buds. The parrot has a very strong mandible that is curved to fit over the lower mandible. With this beak, the parrot is able to crack nuts with ease. The parrot's tongue is also very powerful. The tongue along with the beak and jaws are used to husk seeds before they are eaten. The zygodactyl foot is helpful in manipulating food as it eats. When it eats it is usually up in trees and is unusually quiet for its nature.

(Campbell and Lack 1985; Brooke and Birkhead 1991; Hogle Zoo 1999; Encyclopedia Americana 2000)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

Range lifespan

Status: wild:
27 (high) years.

Average lifespan

Status: captivity:
27 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 27 years (captivity) Observations: One female was still alive after 27 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

These parrots nest in hollow trees and usually lay 2-5 eggs. The egg shells are white. They hatch in 20 and 32 days. Hatchlings are blind and naked. The female parrot feeds and broods them for the first 10 days and later the male aids her in the care. After three weeks the young are ready to leave the nest. Some parrots stay with their parents until the following mating season.

Range eggs per season: 2 to 5.

Range time to hatching: 20 to 32 days.

Average fledging age: 3 weeks.

  • 1983. Academic American Encyclopedia. New York, NY: Groiler Incorporated.
  • Ridgely, R. 1981. A Guide to the Birds of Panama. Princeton, NJ: Princeton University Press.
  • Utah's Hogle Zoo, 1999. "Red-Lored Amazon Parrot" (On-line). Accessed March 12, 2001 at http://www.hoglezoo.org/birds/redlored.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Amazona autumnalis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACTTTACCTAATTTTCGGCGCATGAGCTGGCATAATTGGTACCGCCCTAAGCCTACTCATCCGCGCAGAGCTCGGCCAACCAGGAACTCTCCTCGGAGATGACCAAATCTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATTGGAGGATTCGGAAACTGACTAGTTCCCCTCATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTACTAGCCTCCTCCACAGTAGAAGCAGGGGCAGGCACAGGATGGACAGTCTACCCCCCCCTAGCCGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACTTGGCTGGTGTATCCTCCATTCTAGGGGCAATCAACTTTATCACTACAGCCATCAACATAAAACCACCCGCCTTATCACAATACCAAACCCCACTATTCGTATGATCCGTCCTAATCACAGCCGTGCTGCTACTACTAGCACTACCAGTCCTAGCCGCTGGAATTACCATACTCCTCACAGACCGCAACCTAAACACAACATTCTTCGACCCCGCTGGGGGAGGAGACCCAATCCTATACCAACACCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Amazona autumnalis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 8
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Although the Red-Lored Parrot is not endangered, it is on its way to being endangered. The forests that this parrot live in are slowely being destroyed. People also hunt this parrot for a food source and for its colorful feathers that are used in ceremonial dances. The high demand for these animals as pets has also threatened them. In order to conserve these animals, the rainforest must be maintained.(Brooke and Birkhead 1991)

US Federal List: no special status

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 500,000-4,999,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Major Threats
The species has been heavily traded: since 1981, when it was listed on CITES Appendix II, 55,329 wild-caught individuals have been recorded in international trade (UNEP-WCMC CITES Trade Database, January 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species is listed under CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

These parrots do not live in settled areas around humans. Therefore they do not frequently come in contact with humans. When they do, it is because humans are hunting them. There is more damage done to the parrot population by humans than damage done by parrots to human populations.

(Ridgely 1981)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

The Red-Lored Parrot, like other parrots, is a very popular pet. In captivity, it can live up to 80 years. From youth, they are very easily tamed. Their antics are fun to watch, and this makes their demand as household pets higher. The Red-Lored Parrot has been compared to the African Grey Parrot, as both are very successful at mimicking the human voice. This is the main reason there is a demand for these parrots.

(Encyclopedia Americana 2000; Brooke and Birkhead 1991)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-lored Amazon

A vocalizing Amazona autumnalis
A. a. salvini at Cana Blanca Wildlife Sanctuary, Costa Rica
Head plumage of adults is characteristic, but the cheek color varies among subspecies, with this, A. a. autumnalis, being the only with a bright yellow patch.
A. a. lilacina is local within its already small range, leading to concerns about its status.
A captive-bred Red-lored Parrot chick, shown at age of 6 weeks.
A pet juvenile in Costa Rica

The Red-lored Amazon or Red-lored Parrot (Amazona autumnalis) is a species of Amazon parrot, native to tropical regions of the Americas, from eastern Mexico south to Ecuador, with a disjunct population in central Brazil, where it occurs in humid evergreen to semi-deciduous forests up to 1,100 m altitude. It is absent from the Pacific side of Central America north of Costa Rica. Not originally known from El Salvador, a pair - perhaps escaped from captivity - nested successfully in 1995 and 1996 in the outskirts of San Salvador[2] and the species might expand its range permanently into that country in the future.[3] This species has also established feral populations in several California cities.[4]


Description[edit]

The Red-lored Amazon is 32–35 cm (13 in) in length, with a weight of 310–480 g. The plumage is primarily green, with a red forehead and, in some subspecies, yellow cheeks (sometimes with red spots). The crown is blue. Adult males and females do not differ in plumage. Juveniles have less yellow on the cheeks, less red on the forehead, and dark irises.

Taxonomy[edit]

There are four subspecies:[5]

Behavior[edit]

Food and feeding[edit]

Their food includes fruits,[6] nuts and seeds. Like all parrots, Red Lored Amazons need a varied diet consisting of high quality pellets, a quality seed mix, and daily servings of fresh, bird-safe fruits and vegetables.

Breeding[edit]

The Red-lored Amazon nests in tree cavities. The eggs are white and there are usually three or four in a clutch. The female incubates the eggs for about 26 days and the chicks leave the nest about 60 days after hatching.[7]

Status[edit]

In some areas, notably parts of Mexico and Venezuela, the Red-lored Amazon has become rare through trapping for the cagebird trade. On the other hand, it seems to be able to adapt to human-altered habitat to a considerable degree.[3]

Aviculture[edit]

Red-lored Amazons are fairly common pet parrots in the Americas. They can be devoted pets and some make fairly good talkers. Like most Amazon parrots they often have a tendency to vocalize loudly, and sometimes to bite. Their behavior ranges from being quiet and curious to being aggressive, this can all be changed by basic training when the bird is of young age. Native to the tropical regions of Central and South America, Red Lored Amazon Parrots can grow up to 13 inches in length. While they largely feast on seeds, fruits and nuts, avocados and eggplants are poisonous to them and can kill them. Their average life span is up to 80 years.

Avocado and eggplant are poisonous to them (as they are for many parrots and other animals).

References[edit]

  1. ^ BirdLife International (2012). "Amazona autumnalis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ At San Jacinto Hill, 13°42'N 89°08'W: Herrera et al. (2006).
  3. ^ a b Herrera et al. (2006)
  4. ^ "Flock Information". California Flocks. Retrieved 7 December 2013. 
  5. ^ "Zoological Nomenclature Resource: Psittaciformes (Version 9.004)". www.zoonomen.net. 2008-07-05. 
  6. ^ E.g. of Cymbopetalum mayanum (Annonaceae), Gumbo-limbo (Bursera simaruba), mango (Mangifera indica), figs (Ficus spp.) and palo de hule (Castilla elastica): Herrera et al. (2006), Forster (2007).
  7. ^ Alderton, David (2003). The Ultimate Encyclopedia of Caged and Aviary Birds. London, England: Hermes House. p. 233. ISBN 1-84309-164-X. 
  • Collar, Nigel J. (1997): 313. Red-lored Amazon. In: del Hoyo, Josep; Elliott, Andrew & Sargatal, Jordi (eds.): Handbook of Birds of the World, Volume 4 (Sandgrouse to Cuckoos): 469-470, Plate 54. Lynx Edicions, Barcelona. ISBN 84-87334-22-9
  • Foster, Mercedes S. (2007): The potential of fruiting trees to enhance converted habitats for migrating birds in southern Mexico. Bird Conservation International 17(1): 45-61. doi:10.1017/S0959270906000554 PDF fulltext
  • Herrera, Néstor; Rivera, Roberto; Ibarra Portillo, Ricardo & Rodríguez, Wilfredo (2006): Nuevos registros para la avifauna de El Salvador. ["New records for the avifauna of El Salvador"]. Boletín de la Sociedad Antioqueña de Ornitología 16(2): 1-19. [Spanish with English abstract] PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!