Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 16.2 years (captivity) Observations: One specimen lived 16.2 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pionus maximiliani

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACNTAATCTTCGGCGCATGAGCAGGCATAATTGGCACCGCCCTGAGCCTANTTATCCGCGCAGAACTTGGCCAACCAGGGACTCTCCTTGGGGACGACCAAATCTATAACGTAATCGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATGATTGGGGGATTCGGAAACTGATTAGTCCCCCTCATAATCGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTTCTCCTACTAGCCTCCTCCACAGTAGAGGCAGGAGCGGGTACAGGATGAACTGTCTACCCCCCCCTAGCTGGCAACCTAGCCCACGCCGGAGCCTCAGTAGACCTGGCCATCTTTTCCCTCCACCTAGCTGGCGTATCTTCCATCCTAGGGGCAATTAACTTTATCACCACAGCCATCAACATAAAACCGCCCGCTCTGTCACAATACCAAACCCCACTATTCGTGTGATCCGTCCTAATCACAGCCGTACTACTACTGCTAGCACTACCAGTCCTAGCCGCCGGAATCACTATACTCCTTACAGACCGTAATCTAAACACAACATTCTTCGACCCTGCTGGAGGAGGAGACCCAATCCTATACCAACACCTATTCTGATTCTTCGGACACCCAGAAGTATATATCCTCATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pionus maximiliani

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species has been heavily traded: since 1981, when it was listed on CITES Appendix II, 93,234 wild-caught individuals have been recorded in international trade (UNEP-WCMC CITES Trade Database, January 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species is listed under CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Scaly-headed Parrot

The Scaly-headed Parrot (Pionus maximiliani) is a species of bird in the Psittacidae family, the true parrots. It is also called Scaly-headed Pionus, Maximilian Pionus, Maximilian Parrot, Maximilian's Pionus, or Maximilian's Parrot.

It is found in eastern Brazil, central and eastern Bolivia, Paraguay, and northern Argentina. It is found in a wide range of wooded habitats, from humid subtropical forest to arid Caatinga. It is fairly common throughout a large part of its range. It is typically seen in pairs or small flocks. The scaling to the head for which it is named is typically far less distinct than the bright red undertail coverts (a feature found in all members of the genus Pionus).

In Brazil, they are called cocotas or maritacas (from mbaé'taka, tupi for "noisy bird")

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!