Overview

Brief Summary

The Green Cheeked Conure (Pyrrhura molinae, family Psittacidae) - previously known as Molina's conure - is a long-tailed, small- to mid-sized New world parrot native to South America in southern Brazil, eastern Bolivia, northwestern Argentina and northwestern Paraguay at elevations up to 3000 meters. P. molinae weigh from 60 to 90 grams and measure 25 centimeters long, with dark-grey to blackish heads, green cheeks, brown chest, white eye rings, gray beaks, dark gray legs and a completely maroon tail. In captivity, they are engaging, curious, playful pets with big, scrappy personalities.

It is very similar to the Maroon Conure (Pyrrhura frontalis); recent DNA analysis suggests they may in fact be the same species.

  • Forshaw, J.M., Knight, F. Parrots of the World. Princeton University Press, 2010. p. 216
  • Mancini, J.R. Conure. John Wiley & Sons, 2006. pp 24-25
Public Domain

Supplier: Bob Corrigan

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pyrrhura molinae

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATCTTTGGCGCATGAGCGGGCATAATCGGTACCGCCCTAAGCCTACTTATCCGCGCAGAACTAGGCCAACCCGGGACCCTCTTAGGAGACGACCAGATCTATAATGTAATTGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATGATCGGGGGGTTTGGAAACTGACTAGTTCCCCTCATAATCGGTGCCCCCGACATGGCATTCCCACGCATAAACAACATAAGCTTCTGGTTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCCTCTACAGTAGAGGCAGGCGCCGGTACAGGATGAACAGTCTATCCCCCCCTGGCCGGAAACCTAGCCCACGCCGGGGCATCAGTAGACCTGGCCATCTTCTCCCTTCACCTAGCAGGAGTATCCTCCATCCTAGGTGCAATCAACTTTATCACCACAGCCATCAACATAAAACCACCCGCACTATCACAATATCAAACCCCATTATTCGTCTGATCCGTCCTAATCACAGCAGTACTACTCCTGCTATCTCTCCCAGTCTTAGCTGCCGGAATCACCATACTCCTTACAGACCGCAACCTAAACACCACATTCTTTGACCCTGCCGGAGGGGGAGACCCAATCTTATACCAACACCTCTTTTGATTCTTCGGACACCCAGAAGTATACATCCTCATCCTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pyrrhura molinae

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 6
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Green-cheeked parakeet

The Green-cheeked Parakeet or Green-cheeked Conure (Pyrrhura molinae) is a small parrot of the genus Pyrrhura, which is part of a long-tailed group of the New World parrot subfamily Arinae. This type of parrot is generally called a conure in aviculture. It is native to the forests of South America.

Description[edit]

The Green-cheeked Parrot is typically 26 cm (10 in) long and weighs 60 to 80 g. It is mainly green, with a brown/black/grey crown, white periophthalmic rings, green cheeks, blue primary wing feathers, a grey beak, and its long pointed tail is mostly maroon. It has short transverse striations on its breast and a red abdominal area. Males and females have an identical external appearance.[2]

Taxonomy[edit]

The Green-cheeked Parrot has six subspecies:[2][3]

  • Pyrrhura molinae, (Massena & Souance 1854)
    • P. m. australis, Todd 1915
    • P. m. flavoptera, Maijer, Herzog, Kessler, Friggens & Fjeldsa 1998
    • P. m. hypoxantha,(Salvadori 1899)
    • P. m. molinae, (Massena & Souance 1854)
    • P. m. phoenicura, (Schlegel 1864)
    • P. m. restricta, Todd 1947

P. m. sordida naturally occurs as a green morph or as a yellow morph,[2] The yellow morph is also called the Yellow-sided Conure,[4] and was once erroneously considered to be a separate species, P. hypoxantha.[5] As P. hypoxantha was described before P. m. sordida the older name goes first, therefore P. m. sordida is called P. m. hypoxantha these days.

The Green-cheeked Parrot is similar to the Maroon-bellied Parrot (P. frontalis),[4] and formerly there have been speculations that they were conspecific.[5] It is also similar in appearance to the Blaze-winged Parrot and the Black-capped Parrot.[4]

Distribution and habitat[edit]

The Green-cheeked Parrot occurs in west-central and southern Mato Grosso, Brazil, through northern and eastern Bolivia to northwestern Argentina and northern Paraguay. Its habitat is forests and woodland, where it usually forms flocks of 10 to 20 individuals at treetop level, or larger flocks where there is more food. It is also emerging as a popular pet for families and individuals.[4]

Behavior[edit]

Scratching his neck with a corn cob (an example of tool use).

The Green-cheeked Parrot eats various seeds and fruits and can not eat human food or vegetables. The average clutch is 4–6 eggs. Average incubation is 24 days, varying from 22 to 25 days. They are the quietest of the Conures and can learn tricks and have a limited vocabulary, with extensive training.[6]

Aviculture[edit]

A wing-clipped adult Yellow-sided Green-cheeked Parrot, yellow morph P. m. sordida. Note the lighter coloration.

Green-cheeked Parrots are common in aviculture and are popular companion parrots. They are playful, affectionate and intelligent, known as having a "big personality in a small body". They can learn to talk, albeit with a limited vocabulary and a gravelly voice. They like to be held (although some like it more than others) and can learn tricks such as lying on their backs, "kissing," shaking, hanging upside down and even can be potty trained. Green-cheeked Parrots are quiet, so even a unit dweller can enjoy their companionship.[7] They can be prone to biting, particularly when young, but an owner can cure this behavior with patience and time.

They love fruits, (especially bananas and raisins), and seeds such as sunflower, safflower, and hemp seeds—all found in their natural environments. Green-cheeked Parrot also love table food—they are flock animals and love to eat with their family. They can eat potatoes, carrots, corn, bread, pasta, and plain popcorn. A clipped and/or caged bird can become obese from eating too many fatty seeds such as sunflower seeds and peanuts. A bird-pellet diet with a calcium supplement provides proper nutrition and should comprise 60-70% of their diet.[8] A good rule of thumb is 70% pellet diet, 20% fruit and vegetables and <10% treat items. Parrots with health problems related to the kidneys should not be fed a high protein diet, as it may lead to gout;[9] veterinarian prescribed low-protein diets are available for birds with such conditions. Green-cheeked Parrots can live to 30 years with proper care, though the average lifespan is typically 10 years due to owner neglect.[10]

Colour mutations[edit]

In addition to the natural color forms, color mutants have been selectively bred in aviculture:

  • Cinnamon are lime green and have a lighter, almost pale color to the feathers. The head is tan and the tail feathers are a lighter maroon than in normal Green-cheeked Parrots.
  • Yellow-sided have a breast of bright colors.
  • Pineapple is cinnamon and yellow-sided combination. They have a breast of bright colors, a tan head and lime green feathers on the back like a cinnamon Green-cheeked Parrot. The tail feathers are the same as a yellow-sided, showing a halo effect.
  • Turquoise have a body with some blue-green and green feathers. The breast feathers are grayish and the tail feathers are gray.

A green/red/blue apple mutation is not very common but has been seen.

References[edit]

  1. ^ a b BirdLife International (2012). "Pyrrhura molinae". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c Forshaw (2006). plate 85.
  3. ^ "Zoological Nomenclature Resource: Psittaciformes (Version 9.026)". Zoonomen.net. 2009-07-26. 
  4. ^ a b c d Forshaw (2006). page 114.
  5. ^ a b Juniper; Parr (1998). Parrots: A Guide to Parrots of the World. p. 462. ISBN 0-300-07453-0. 
  6. ^ Lara. "The Green Cheek Conure Homepage". Gcch.tripod.com. Retrieved 2013-10-17. 
  7. ^ "Specialist Breeders - Birds for Sale - All About Green Cheek Conures". All About Birds. Retrieved 2013-01-15. 
  8. ^ "Green Cheek Conure". Petco.com. Retrieved 2013-10-20. 
  9. ^ "Gout in Pet Birds". 2ndchance.info. Retrieved 2013-10-20. 
  10. ^ "Green Cheeked Conure". Central Pets Educational Foundation. Web Archive Copy. Archived from the original on 2008-02-12. 
  11. ^ "Yellow sided green cheek conure". Commons.wikimedia.org. Retrieved 2031-10-20. 

Works cited[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!