Articles on this page are available in 1 other language: Spanish (9) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pyrrhura hoffmanni

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATCTTTGGCGCATGAGCGGGCATAATCGGCACCGCCCTAAGCCTACTTATCCGCGCAGAACTAGGCCAACCCGGGACCCTCCTAGGAGACGACCAAATCTACAATGTAATTGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATACCAATCATGATTGGGGGGTTTGGAAACTGACTAGTTCCCCTCATAATCGGTGCTCCCGACATGGCATTCCCACGCATGAACAACATAAGCTTCTGATTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCCTCCACAGTAGAAGCAGGCGCCGGCACCGGATGAACAGTCTATCCCCCCCTAGCCGGAAACCTAGCCCACGCTGGGGCATCAGTAGACCTGGCCATCTTCTCTCTCCACCTAGCAGGAGTATCCTCCATCCTAGGTGCAATCAACTTTATCACCACCGCCATCAACATAAAACCGCCCGCACTATCACAATATCAAACCCCATTATTCGTCTGATCCGTCCTAATCACAGCAGTACTACTCCTACTATCTCTCCCAGTCTTAGCTGCCGGAATCACCATACTCCTTACAGACCGCAACCTAAACACCACATTCTTTGACCCCGCCGGAGGAGGAGACCCAATCTTATACCAACACCTC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pyrrhura hoffmanni

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a small range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Sulphur-winged parakeet

The sulphur-winged parakeet (Pyrrhura hoffmanni), also known as the Hoffmann's conure in aviculture, is a medium-small parrot endemic to humid highland forests and woodlands in Costa Rica and western Panama. It occurs up to 3000 m asl, and locally down to 1300 m in the wet season. It is named for the German naturalist Karl Hoffmann.

Description[edit]

ConurusHoffmanniSmit.jpg

The sulphur-winged parakeet is 23 cm long and weighs 75 g. The adult is mainly green. Scaled with orange-yellow on the head and chest. There is a red spot on the auriculars and the tail is broadly tipped dull red (entirely dull red from below). The outer primaries are blue, but the most obvious feature in flight is the extensive yellow on the inner wing. Young birds are similar to the adults, but duller and with much less yellow in the wing.

Behaviour[edit]

The flight call of the sulphur-winged parakeet a grating toweet-deet-deet-toweet, and when perched it has a reedy zeeweet.

Food and feeding[edit]

Sulphur-winged parakeet feeds in flocks of 5-15 birds at treetop level, taking various seeds and fruits including figs.

Breeding[edit]

The white eggs are laid in an unlined nest cavity 8–20 m high in a tree, which may be an old woodpecker hole or a broken stub.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!