Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Pyrrhura egregia

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTTACCTAATCTTTGGCGCATGAGCGGGCATAATCGGCACCGCCCTAAGCCTACTTATCCGCGCAGAACTAGGCCAACCCGGGACCCTCCTAGGAGATGACCAAATCTATAATGTAATTGTCACAGCCCATGCCTTCGTAATAATCTTCTTCATGGTAATGCCAATTATGATTGGGGGGTTTGGAAACTGACTAGTTCCCCTCATAATCGGTGCTCCCGACATGGCATTCCCACGCATGAACAACATAAGCTTCTGGTTACTCCCCCCATCCTTCCTCCTCCTACTAGCCTCCTCTACAGTAGAAGCAGGCGCTGGCACAGGATGAACAGTCTATCCCCCCCTGGCCGGAAACCTAGCCCACGCCGGGGCATCAGTAGACCTAGCCATCTTCTCTCTTCACCTAGCAGGAGTATCCTCCATCCTAGGTGCAATCAACTTTATCACCACAGCCATCAACATAAAACCACCCGCACTATCACAATATCAAACCCCATTATTCGTCTGATCCGTCCTAATCACAGCAGTACTACTTCTACTATCTCTCCCAGTCTTAGCTGCCGGAATCACCATACTCCTTACAGACCGCAACCTAAACACCACATTCTTTGACCCTGCCGGAGGGGGGGACCCAATCTTATACCAACACCTCTTCTGA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Pyrrhura egregia

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
Although this species may have a restricted range, it is not believed to approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Fiery-shouldered parakeet

The fiery-shouldered parakeet (Pyrrhura egregia), also known as the fiery-shouldered conure, is a species of parrot in the family Psittacidae. It is found in Brazil, Guyana, and Venezuela. Its natural habitat is subtropical or tropical moist montane forests. There are two subspecies, P. e. egregia and P. e. obscura.

Description[edit]

The fiery-shouldered parakeet grows to a length of about 26 cm (10 in) and weighs about 75 g (2.6 oz). In the nominate subspecies (P. e. egregia), the head is grey and the neck and upper parts of the body and wings are green. The front edge of the wing and the underwing coverts are yellow with orange markings. The breast is green barred with brown and yellowish-white. The central part of the abdomen is reddish-brown, as is the upper side of the tail while the underside of the tail is grey. The eye is brown and surrounded by bare white skin, and the beak is horn-coloured. In the other subspecies, P. e. obscura, the upper parts are a deeper shade of green and there is little or no bright colour on the abdomen.[2][3]

Distribution and habitat[edit]

The fiery-shouldered parakeet is endemic to an area of tropical rainforest in South America that includes Bolivia, Guyana, Brazil and Venezuela. Its total area of occupancy is about 50,000 square kilometres (19,000 sq mi) and includes part of the Canaima National Park.[4] The subspecies P. e. egregia is found in southeastern Venezuela and southwestern Guyana while P. e. obscura occurs in southern Venezuela and northeastern Brazil.[5] These parrots are found in primary and secondary forests at altitudes between 700 and 1,800 metres (2,300 and 5,900 ft) and also woodland verges, sometimes visiting parks and gardens.[3]

Behaviour[edit]

The fiery-shouldered parakeet is usually seen in small groups of up to 25 individuals. They fly fast and agilely between trees, often emitting shrill cries when they take off. They are rather shy and are adept at hiding themselves among the foliage. They forage in the canopy for plant material and particularly appreciate feeding on Cecropia trees.[3] Little is known of the breeding habits of these birds.[5]

Conservation status[edit]

Although the fiery-shouldered parakeet has a restricted range it has been described as being "fairly common". Its rainforest habitat is under threat from logging and its numbers are thought to be declining, however the rate of decline is slow and the International Union for Conservation of Nature has assessed the bird as being of "least concern".[4]

References[edit]

  1. ^ BirdLife International (2012). "Pyrrhura egregia". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 2013-09-04. 
  2. ^ "Fiery-shouldered conure". All about parrots. World Parrot Trust. 2013. Retrieved 2014-09-01. 
  3. ^ a b c Le-Dantec, Daniel (2011-12-18). "Conure aile-de-feu: Pyrrhura egregia: Fiery-shouldered Parakeet" (in French). Oiseaux.net. Retrieved 2014-09-04. 
  4. ^ a b "Fiery-shouldered Parakeet Pyrrhura egregia". BirdLife International. Retrieved 2014-09-04. 
  5. ^ a b Collar, N.; Bonan, A.; Boesman, P. (2013). "Fiery-shouldered Parakeet (Pyrrhura egregia)". Handbook of the Birds of the World. Lynx Edicions. Retrieved 2014-09-07. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!