Articles on this page are available in 1 other language: Chinese (Simplified) (10) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Monticola solitarius

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTAATTTTCGGCGCATGAGCCGGAATAGTGGGTACCGCCCTAAGCCTCCTCATTCGAGCAGAGCTGGGCCAACCAGGCGCCCTACTAGGAGACGACCAAGTCTACAACGTAGTCGTCACAGCCCATGCTTTCGTAATAATTTTCTTCATAGTCATACCAATTATAATCGGAGGATTCGGAAACTGACTAGTCCCCCTAATAATCGGAGCCCCAGATATAGCCTTCCCTCGAATAAACAACATAAGCTTCTGACTACTCCCTCCATCCTTCCTGCTCCTCCTAGCCTCCTCTACCGTTGAAGCAGGGGTAGGAACCGGCTGAACTGTATACCCTCCCCTAGCCGGCAACTTAGCCCACGCCGGAGCCTCAGTCGACCTGGCCATCTTCTCTCTCCACTTAGCAGGTATCTCCTCAATCCTAGGCGCTATCAACTTTATCACAACAGCAATCAACATAAAACCTCCAGCCCTTTCACAGTACCAAACCCCTCTCTTCGTATGATCCGTCCTAATCACTGCAGTCCTCCTCCTACTATCCCTCCCAGTTCTAGCTGCAGGCATTACCATGCTTCTCACTGACCGTAATCTAAATACCACCTTCTTCGACCCTGCAGGAGGGGGAGACCCAGTACTTTACCAACATCTTTTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Monticola solitarius

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status in Egypt

Regular passage visitor, winter visitor and resident breeder.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Bibliotheca Alexandrina

Source: Bibliotheca Alexandrina - EOL Ar

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 120000-260000 breeding pairs, equating to 360000-780000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 735000-3120000 individuals, although further validation of this estimate is needed.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Blue Rock Thrush

The Blue Rock Thrush (Monticola solitarius) is a species of chat. This thrush-like Old World flycatcher was formerly placed in the family Turdidae.

This species breeds in southern Europe and northwest Africa, and from central Asia to northern China and Malaysia.

The European, north African and southeast Asian birds are mainly resident, apart from altitudinal movements. Other Asian populations are more migratory, wintering in sub-Saharan Africa, India and southeast Asia. This bird is a very uncommon visitor to northern and western Europe.

Blue Rock Thrush breeds in open mountainous areas, usually higher than the breeding zone of the related Common Rock Thrush. It nests in rock cavities and walls, and usually lays 3-5 eggs. An omnivore, the Blue Rock Thrush eats a wide variety of insects and small reptiles in addition to berries and seeds.

This is a starling-sized bird, 21–23 cm in length with a long slim bill. The summer male is unmistakable, with all blue-grey plumage apart from its darker wings. Females and immatures are much less striking, with dark brown upperparts, and paler brown scaly underparts. Both sexes lack the reddish outer tail feathers of Rock Thrush.

The male Blue Rock Thrush sings a clear, melodious call that is similar to, but louder than the call of the Rock Thrush.

The Blue Rock Thrush is Malta's national bird and is shown on the Lm 1 coins that was part of the previous currency of the country.

Gallery [edit]

References [edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!