Articles on this page are available in 1 other language: Spanish (11) (learn more)

Overview

Distribution

Range

Humid lowlands of se Nicaragua, Costa Rica and w Panama.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Bocas del Toro-San Bastimentos Island-San Blas Mangroves Habitat

This taxon is found in the Bocas del Toro-San Bastimentos Island-San Blas mangroves ecoregion, but not necessarily exclusive to this region. The Bocas del Toro-San Bastimentos Island-San Blas mangroves is one of the ecoregions of Panama, situated on the Caribbean coast of northern Panama. Precipitation in this region, entirely in the form of rainfall, amounts to approximately 6000 mm per annum. This ecoregion is largely comprised of mangrove swamps and contains an extensive coral reef system that protects the mangroves by moderating ocean wave action; in turn the mangroves trap sediment and promote water clarity than enhance coral reef development. Extensive submerged areas of this ecoregion are considered seagrass meadows, a highly biodiverse marine ecosystem that has high primary productivity as well as considerable species richness In the shallower waters are found manatee along with numerous corals, sponges, pipefishes and baracuda. The deeper coastal waters are habitat for dolphins, most notably at Dolphin Bay, somewhat south of Bastimentos Island.

The dominant shoreline ecoregion feature is the presence of Red Mangrove trees, whose submerged roots stabilize the shoreline. The near coastal zone and low elevation upland areas of this ecorefion also support a host of other flora, as well as birds, mammals, amphibians and arthropods.

Birdlife at the coastal upland and rich coastal riparian zone and other near shore upland habitats is quite diverse. A notable terrestrial bird endemic to the Bocas del Toro region is the Brown Parakeet. Another notable bird found in this ecoregion is the Pale-billed woodpecker, Campephilus guatemalensis, a large bird, who is found at the southern limit of his range here. The White-fronted nunbird, Monasa morphoeus, is a near passerine species found at the moist lowland forest edge, including secondary growth. Another bird found here that is tolerant of degraded forest is the Crimson-fronted parakeet, Aratinga finschi. A specialist bird to the mangroves and also dense somewhat upland areas of Bocas is the Rufous-necked wood-rail, Aramides axillaris. The Bare-necked umbrella bird is normally found at the higher elevation margin of the Bocas area, but can often be found in the near coastal fringe in non-breeding season.

Mammalian species include the Collared-peccary, who may be found in mainland Bocas del Toro lowland moist forest or grasslands. Also found here is the critically endangered Pygmy three-toed sloth, Bradypus pygmaeus, whose extant population of no more than a few hundred animals is restricted to the tiny (3.4 km2) island of Isla Escudo de Veraguas. There are also Central American red brocket, Mazama temama, a species of forest deer widespead in Mesoamerica.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Aratinga finschi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACCTAATCTTCGGCGCATGAGCAGGTATAATCGGCACCGCCCTGAGCCTGCTCATTCGCGCAGAACTCGGTCAACCGGGGACTCTCCTAGGAGACGACCAGATCTATAATGTGATTGTCACAGCCCATGCCTTCGTGATAATCTTCTTCATAGTAATACCAATCATGATTGGGGGATTTGGAAACTGATTAGTCCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTACTAGCTTCCTCCACAGTAGAAGCAGGCGCCGGCACAGGTTGAACAGTCTACCCCCCCTTGGCCGGAAACCTAGCCCACGCCGGAGCATCAGTGGACCTAGCCATCTTTTCCCTCCACCTAGCAGGAGTATCCTCCATCCTAGGCGCAATCAACTTTATTACTACAGCCATCAACATAAAACCACCCGCACTATCACAATACCAAACCCCCCTATTTGTCTGATCCGTCCTAATCACAGCAGTGTTACTCCTACTATCTTTACCAGTCCTAGCTGCTGGAATCACCATACTCCTTACAGATCGTAACCTAAACACCACATTCTTCGATCCTGCCGGGGGAGGAGACCCAATCTTATACCAACACCTC
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Aratinga finschi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 3
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!