Overview

Brief Summary

The Red-and-green Macaw (Ara chloropterus) is a large, mostly red parrot with a long tail, conspicuous green upperwing coverts, and a large bill. It is most easily distinguished from the largely sympatric (i.e., geographically co-occurring) Scarlet Macaw (A. macao) by the fact that it has green upperwing coverts (bright yellow in Scarlet Macaw, although immature Red-and-green Macaws may show some yellowish green), red feathered lines on the twin white face patches, and a slightly larger size.

Red-and-green Macaws are usually seen in pairs, small flocks of several pairs, or (less frequently) family groups. They sometimes associate with Scarlet or Blue-and-yellow Macaws (Ara ararauna). In the northern part of their range, Red-and-green Macaws tend to inhabit terra firme rainforest (forests that do not experience seasonal flooding), apparently avoiding swampy areas. In the southern and eastern parts of the range, they are often found in more open and drier habitats. They have been reported to elevations of 1000 m in Panama, 500 m in Colombia, and 1400 m in Venezuela. Large trees with cavities are generally required for nesting, but in some areas they nest in crevices in rock faces. Red-and-green Macaws are generally absent near human population centers. Birds forage in the canopy, feeding on fruits and seeds.

Red-and-green Macaws are found in eastern Panama and South America south to (at least reported formerly, though conceivably based on escaped captives) northern Argentina. This species is generally uncommon due to population declines from capture for the pet trade, habitat loss, and hunting. It is locally distributed in Panama, Venezuela, and Bolivia, but widespread throughout much of the Amazon basin. It is also widespread in captivity. 

Collar (1997) argues that the spelling of the specific epithet is probably more appropriately "chloroptera" rather than "chloropterus".

(Collar 1997 and references therein; Juniper and Parr 1998 and references therein)

  • Collar, N.J. 1997. Red-and-green Macaw (Ara chloroptera). P. 422 in: del Hoyo, J., Elliott, A., and Sargatal, J., eds. Handbook of the Birds of the World. Volume 4. Sandgrouse to Cuckoos. Lynx Edicions, Barcelona.
  • Juniper, T. and M. Parr. 1998. Parrots: A Guide to Parrots of the World. Yale University Press, New Haven, Connecticut.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Humid e Panama to Brazil, e Peru, ne Bolivia and Paraguay.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

 

Partner Web Site: Cornell Laboratory of Ornithology

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 50.1 years (captivity) Observations: One male specimen was still alive after 50.1 years in captivity when it was sold (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ara chloropterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGTACCGCCTTGAGCCTGCTCATCCGTGCAGAACTCGGTCAGCCAGGGACCCTTCTAGGAGACGACCAGATCTATAATGTAGTTGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATGATCGGAGGGTTCGGGAACTGACTAGTCCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTACTGGCCTCCTCTACAGTGGAAGCAGGTGCTGGTACGGGCTGAACAGTCTACCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGGGCATCAGTGGACCTAGCCATCTTCTCCCTTCACCTAGCAGGGGTATCCTCCATCCTAGGAGCAATTAACTTTATTACCACGGCCATCAACATAAAACCACCTGTACTATCACAATACCAAACCCCGCTATTTGTCTGATCTGTCCTAATCACAGCCGTACTACTTCTGCTATCCCTACCAGTCCTCGCTGCTGGAATCACCATACTCCTTACAGACCGTAACCTAAATACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCAGTCTTGTACCAACACCTCTTCTGAT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ara chloropterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-and-green Macaw

The Green-winged macaw (Ara chloropterus), also known as the Red and Green macaw, is a large mostly-red macaw of the Ara genus.

This is the largest of the Ara genus, widespread in the forests and woodlands of northern and central South America. However, in common with other macaws, in recent years there has been a marked decline in its numbers due to habitat loss and illegal capture for the parrot trade.

Contents

Description

The Green-winged macaw can be readily identified from the Scarlet Macaw as whilst the breast of both birds is bright red, the upper-wing covert feathers of the Green-winged macaw are mostly green but can occasionally sport a few yellow feathers above the band of green (as opposed to mostly yellow, or a strong mix of yellow and green in the Scarlet Macaw). In addition, the Green-winged macaw has characteristic red lines around the eyes formed by rows of tiny feathers on the otherwise bare white skin patch; this is one of the biggest differences from a Scarlet Macaw to the casual viewer. Iridescent teal feathers are surrounded by red on the tail. If seen together, the Green-winged macaw is clearly larger than the Scarlet Macaw as well.

It is second only in size to the Hyacinth Macaw, the largest bird of the macaw family. The wingspan of the Green-winged macaw can be up to 49 inches (125 cm), with a total body length of 35–37 inches (90–95 cm).[citation needed] A healthy adult will weigh between 1,250 and 1,700 grams (2.7-3.7 lbs).[citation needed]

Behavior

The Green-winged macaw generally mates for life. The female typically lays two or three eggs in a nest made in a hole in a tree. The female incubates the eggs for about 28 days, and the chicks fledge from the nest about 90 days after hatching.[2]

Aviculture

This species is regarded as an affectionate pet. They require food, water and a large cage.

Gallery

The upper body, showing the head and neck details 
Two macaws at La Palmyre Zoo, Les Mathes, France 
At Birmingham Zoo, Alabama, USA 
Four wild Green-winged macaws flying in Peru 

References

  1. ^ BirdLife International (2012). "Ara chloropterus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106001552. Retrieved 16 July 2012.
  2. ^ Alderton, David (2003). The Ultimate Encyclopedia of Caged and Aviary Birds. London, England: Hermes House. p. 235. ISBN 1-84309-164-X.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!