Overview

Brief Summary

The Red-and-green Macaw (Ara chloropterus) is a large, mostly red parrot with a long tail, conspicuous green upperwing coverts, and a large bill. It is most easily distinguished from the largely sympatric (i.e., geographically co-occurring) Scarlet Macaw (A. macao) by the fact that it has green upperwing coverts (bright yellow in Scarlet Macaw, although immature Red-and-green Macaws may show some yellowish green), red feathered lines on the twin white face patches, and a slightly larger size.

Red-and-green Macaws are usually seen in pairs, small flocks of several pairs, or (less frequently) family groups. They sometimes associate with Scarlet or Blue-and-yellow Macaws (Ara ararauna). In the northern part of their range, Red-and-green Macaws tend to inhabit terra firme rainforest (forests that do not experience seasonal flooding), apparently avoiding swampy areas. In the southern and eastern parts of the range, they are often found in more open and drier habitats. They have been reported to elevations of 1000 m in Panama, 500 m in Colombia, and 1400 m in Venezuela. Large trees with cavities are generally required for nesting, but in some areas they nest in crevices in rock faces. Red-and-green Macaws are generally absent near human population centers. Birds forage in the canopy, feeding on fruits and seeds.

Red-and-green Macaws are found in eastern Panama and South America south to (at least reported formerly, though conceivably based on escaped captives) northern Argentina. This species is generally uncommon due to population declines from capture for the pet trade, habitat loss, and hunting. It is locally distributed in Panama, Venezuela, and Bolivia, but widespread throughout much of the Amazon basin. It is also widespread in captivity. 

Collar (1997) argues that the spelling of the specific epithet is probably more appropriately "chloroptera" rather than "chloropterus".

(Collar 1997 and references therein; Juniper and Parr 1998 and references therein)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

eastern Panama south, east of the Andes, to Bolivia, Brazil, and Paraguay; formerly also northeastern Argentina.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 50.1 years (captivity) Observations: One male specimen was still alive after 50.1 years in captivity when it was sold (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ara chloropterus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 6 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGTACCGCCTTGAGCCTGCTCATCCGTGCAGAACTCGGTCAGCCAGGGACCCTTCTAGGAGACGACCAGATCTATAATGTAGTTGTTACAGCCCATGCCTTCGTAATAATCTTCTTCATAGTAATGCCAATCATGATCGGAGGGTTCGGGAACTGACTAGTCCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTACTGGCCTCCTCTACAGTGGAAGCAGGTGCTGGTACGGGCTGAACAGTCTACCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGGGCATCAGTGGACCTAGCCATCTTCTCCCTTCACCTAGCAGGGGTATCCTCCATCCTAGGAGCAATTAACTTTATTACCACGGCCATCAACATAAAACCACCTGTACTATCACAATACCAAACCCCGCTATTTGTCTGATCTGTCCTAATCACAGCCGTACTACTTCTGCTATCCCTACCAGTCCTCGCTGCTGGAATCACCATACTCCTTACAGACCGTAACCTAAATACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCAGTCTTGTACCAACACCTCTTCTGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ara chloropterus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 12
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5