Articles on this page are available in 1 other language: Spanish (23) (learn more)

Overview

Distribution

Ara macao is found in southern Mexico, Central America, and South America. In South America, the species is found as far south as northeastern Argentina. Ara macao is most common throughout the Amazon basin.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Slud, P. 1964. Birds of Costa Rica. New York: Bulletin of the American Museum of Natural History, Volume 128.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Scarlet macaws are brightly colored birds with feathers ranging in color bands from scarlet on their head and shoulders, to yellow on their back and mid wing feathers and blue on the wing tips and tail feathers. The face has short white feathers. This area surrounds the light yellow colored eyes. The long, thick beak is light on the top and dark black on the bottom. The legs and feet are also black (Aditays, 2000).

Body length is approximately 89 cm, with the tail comprising approximately 1/3 - 1/2 of this. Tail feathers of males may be longer than females. Also, bills of males may be slightly larger (Sick, 1993).

Average mass: 1200 g.

Average length: 89 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 1040 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Petén-Veracruz Moist Forests Habitat

This taxon is found in the Petén-Veracruz moist forests, a broadleaf forest ecoregion in mainly mountainous terrain that extends through most of Belize northward through parts of Guatemala and into southern Mexico. This forested ecoregion covers an area of approximately 149,100 square kilometres. Endemism of this ecoregion is moderate, with amphibian endemism particularly notable, and overall species richness is high; vertebrate taxa found here, for example, total 988 species.

Soils within the Petén-Veracruz moist forests are relatively rich in nutrients compared to other tropical regions; this fact may assist in explaining the early advanced civilisations of the Maya people in this area. There are numerous rivers and lakes within this Neotropical realm ecoregion; in some cases the rivers penetrate limestone karst strata and produce spectacular underwater river caverns. Major southern rivers in the Belize portion of the ecoregion include the Mopan and Macal Rivers; the Macal cuts through dense jungle.

Common tree species in the Maya Mountains area include Cohune Palm (Attalea cohune), Ironwood (Dialium guianense), Bitterwood (Simarouba amara), Quamwood (Schizolobium parahybum), as well as tree ferns such as Cyathea myosuroides and Cyathea multiflora.

The ecoregion boasts numerous reptiles, including one of the world's most venomous snakes, the Fer-de-lance (Bothrups asper); this species is both aggressive and highly lethal, with an unusually vivid sexual dimorphism, the female displaying much greater size than the male. A reptilian endemic to the ecoregion is the Tehuantepec Hooknose Snake (Ficimia variegata), known only to Isthmus of Tehuantepec, in Mexico; another ecoregion endemic is the Veracruz Graceful Brown Snake (Halopeltis cuneata). A number of lizards also inhabit the ecoregion, including the rather common lizard of the ecoregion that also occurs in neighbouring dry forests, the Brown Basilisk (Basiliscus vittatus); this olive brown species is noted for the male’s large flaplike crest that is supported by flexible cartilage. A more notable lizard of the Atlantic slopes of the ecoregion is Hernandez’s Helmeted Basilisk (Corytophanes hernandezii); this reddish brown reptile typically sits quietly with its cryptic colouration to avoid predation. The Yucatan Banded Gecko (Coleonyx elegans) is the only gecko of the region with well developed eyelids.

A number of anuran species are found in the Peten-Veracruz moist forests, including the ecoregion endemic Godman's Treefrog (Tlalocohyla godmani), found only in northeastern and western Querétaro, northeastern Puebla and Veracruz, southward to south-central Veracruz, Mexico.  Another ecoregion endemic frog is the Chiapas Dwarf Robber Frog (Craugastor montanus EN), found only in cloud and mixed forests of Cerro Ovando and surroundings, within the Sierra Madre de Chiapas, Mexico. Another ecoregion endemic is the Oaxacan Fringe-limbed Treefrog (Ecnomiohyla echinata CR), known only to northern slopes of the Sierra de Juárez, in the vicinity of Vista Hermosa, Oaxaca, Mexico. Further, the Maya Mountains Frog (Lithobates juliani) is endemic to the ecoregion, known only to the Maya Mountains within Belize.

The Black Jumping Salamander (Pseudoeurycea nigra), endemic to the Peten-Veracruz moist forests ecoregion, is found only on the Caribbean versant of the northern highlands region of Chiapas, Mexico. Another salamander endemic to the ecoregion is the Sierra Juarez Moss Salamander (Cryptotriton adelos), found on the Atlantic versant of the Sierra de Juarez, Pena Verde, and at Sierra de Mazateca on the Guelatao-Vista Hermosa transect, north-central Oaxaca, Mexico. The Black-spotted False Salamander (Pseudoeurycea nigromaculata CR) occurs at only two locales in southern Veracruz, Mexico: the peak of Cerro Chicahuaxtla, Cuatlalpan and on Volcán San Martín.

Numerous bird taxa are found in this ecoregion. The Scarlet Macaw (Ara macao) is found broadly in Central America's moist forests and is well represented in the Maya Mountains and further north in the ecoregion. Another broadly distributed tropical bird found in the ecoregion is the Mealy Parrot (Amazona farinosa), which is one of the largest parrots of the Americas.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© C. Michael Hogan

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Scarlet macaws are found high in the canopy of rainforest habitats below 1,ooo m (Slud, 1964).

Range elevation: 1000 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Scarlet macaws primarily eat fruit and nuts, and will occasionally supplement their diet with nectar and flowers. Ara macao individuals are known to consume fruits before they are ripe. Premature fruits have a tougher skin and pulp that is difficult to access unless the bird has a beak large enough to tear into it. By accessing these fruits before they are available to other animals, they may gain a competitive advantage. Scarlet macaws are also able to break open the toughest nuts. Parrots have more movement in their beaks than do other birds, which allows for a more powerful bill. This ability creates an important food resource for the parrots because not a lot of other animals are able to access such a large variety of nuts (Aditays, 2000). There are structures on the inside of their beaks that allow scarlet macaws to press the hard seed between their tongue and palate and grind the seed so that it can be digested (Sick, 1993).

Scarlet macaws occasionally consume clay found on the banks of rivers. This aids in digestion of the harsh chemicals such as tannins that are ingested when eating premature fruit (Aditays, 2000).

Plant Foods: seeds, grains, and nuts; fruit; nectar; flowers

Primary Diet: herbivore (Frugivore , Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Scarlet macaws are important seed predators of large tree fruits in the ecosystems in which they live. They may influence the generation of forest tree species.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

As adults scarlet macaws may escape most predation by virtue of their size and flight. Young may be taken in the nest by arboreal predators such as snakes, monkeys, and other small carnivores. Adults and fledglings may also be taken by large cats, such as jaguars, and by eagles and hawks.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Scarlet macaws communicate with a variety of vocalizations and postures. Mated pairs are engaging in tactile communication when preening.

Scarlet macaws have excellent vision and hearing.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Large macaws may live up to 75 years in captivity. Typical lifespans in the wild and in captivity are closer to 40 to 50 years.

Range lifespan

Status: wild:
33 (high) years.

Typical lifespan

Status: wild:
40 to 50 years.

Average lifespan

Status: captivity:
64.0 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 33 years (captivity) Observations: There is an anecdotal report of one specimen living to be 64 years of age (Flower 1938). One female was still alive after 33 years in captivity but it rarely flew probably because of its age; it bred with a 32 year-old male for 22 years, until both were nearly 30 years of age (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Scarlet macaws form monogamous pair bonds that last for life.

Mating System: monogamous

Breeding in Ara macao occurs about every one to two years. The clutch size is 2 to 4 white, rounded eggs with an incubation period of 24 to 25 days. Females mainly incubate the eggs. After hatching, the young may stay with their parents for one to two years. The male feeds the young by regurgitating and liquefying food (Sick, 1993). The parents will not raise another set of eggs until the previous young have become independent (Aditays, 2000). Scarlet macaws reach sexual maturity at three or four years of age (Sick, 1993).

Breeding interval: Breeding occurs every one to two years.

Breeding season: Breeding may occur year-round.

Range eggs per season: 2 to 4.

Range time to hatching: 24 to 25 days.

Range time to independence: 1 to 2 years.

Average age at sexual or reproductive maturity (female): 3-4 years.

Average age at sexual or reproductive maturity (male): 3-4 years.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both male and female scarlet macaws care for their young. Scarlet macaws have an extended period of dependence on their parents, with perhaps some significant learning occuring before they become sexually mature and independent.

Parental Investment: no parental involvement; altricial ; pre-fertilization (Protecting: Male, Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Protecting: Male, Female); post-independence association with parents; extended period of juvenile learning

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Lipochromes create red feathers: scarlet macaw
 

The feathers of scarlet macaws gain their red coloration via five lipochromes produced only in parrots.

     
  "In this first examination of the variety of colourful pigments present in parrot feathers, we studied 44 parrot species from 27 genera and found that they all use the same set of five lipochromes to colour their feathers red…Red parrot feathers also differ in colour intensity, from the light-pink hue of several cockatoos to the deep red of red lories (Eos bornea)…The only reports of these pigments in nature are from parrot feathers…There are several other lines of evidence that point to a non-dietary origin of these pigments, including (i) the absence of these pigments from diet samples of certain captive parrots (K.J.M., personal observation) and (ii) the ability of parrots to maintain striking plumage colouration in captivity despite tremendous variation in diet (which is not the case for diet-derived carotenoid colouration; reviewed in Stradi et al. 2001). Stradi et al. (2001) supposed that parrots derive these acyclic polyenal lipochromes either by the addition of acetate units to acetyl CoA or by fatty-acid desaturation. What remains unclear is why parrots are the only group of organisms capable of manufacturing/harbouring these colourants." (McGraw and Nogare 2005:41-42)
  Learn more about this functional adaptation.
  • McGraw, K. J.; Nogare, M. C. 2005. Distribution of unique red feather pigments in parrots. Biology Letters. 1(1): 38-43.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ara macao

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTA---AATCGATGATTATTCTCAACCAACCACAAAGACATTGGCACCCTCTACCTAATCTTCGGCGCATGAGCAGGCATAGTTGGTACCGCCTTGAGCCTGCTCATCCGTGCAGAACTAGGTCAGCCAGGAACCCTCCTAGGAGACGACCAGATTTATAATGTAGTTGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATAGTAATACCAATCATGATTGGAGGATTTGGGAACTGACTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCGCGCATAAACAACATAAGCTTCTGACTACTTCCTCCATCCTTCCTCCTCCTACTAGCCTCCTCTACAGTAGAAGCAGGTGCTGGTACGGGCTGAACAGTCTATCCCCCCTTAGCCGGAAACCTAGCCCATGCTGGGGCATCAGTGGACCTAGCCATCTTCTCCCTTCACCTAGCAGGGGTATCCTCCATCCTAGGGGCAATCAACTTTATTACCACAGCCATCAACATAAAACCACCTGTACTATCACAATACCAAACCCCACTATTTGTCTGATCTGTCCTAATCACAGCCGTATTGCTTCTACTATCCCTACCAGTCCTCGCTGCTGGAATCACCATACTCCTTACAGATCGTAACCTAAATACCACATTCTTCGACCCTGCTGGAGGAGGAGACCCAGTCTTGTATCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTATACATCCTCATCTTACCAGGGTTTGGGATCATCTCCCATGTAGTAGCCTACCATGCAGGTAAAAAGGAGCCATTTGGCTACATGGGCATGGTATGAGCAATACTATCAATCGGATTCCTAGGGTTCATTGTATGGGCCCATCA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ara macao

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size may be moderately small to large, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5