Overview

Brief Summary

The Blue-and yellow Macaw (Ara ararauna) is a very large parrot that is ultramarine blue above and mostly golden yellow below with a long tail, a large black bill, and a bare white facial patch on each side of its head with narrow lines of black feathers. The very similar (but far rarer) Blue-throated Macaw (Ara glaucogularis) has a broadly blue throat, leaving just a stripe of yellow going up each side of the neck.

Blue-and-yellow Macaws occur from eastern Panama and the tropical lowlands of South America to southeastern Brazil, Bolivia, and, at least formerly, Paraguay (they formerly occurred on Trinidad as well, but were extinct there by around 1970). They are found in wooded country, often near water. They sometimes forage in more open country, coming to the ground to feed on fallen fruits. These are gregarious, often noisy birds, usually seen in pairs, family parties, or flocks of up to 25 (or even more) individuals. They feed on a range of fruits (especially palm fruits), nuts, leafbuds, etc. Large numbers may congegate at certain riverbank locations, often with other parrot species, to ingest the mineral-rich soils exposed there. Blue-and-yellow Macaws nest high up in cavities in dead palms.

Although still common over much of their range, in other areas Blue-and-yellow Macaws have been extirpated or are currently threatened or endangered.

(Collar 1997 and references therein; Juniper and Parr 1998 and references therein)

Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Ara ararauna (blue-and-yellow macaws) can be found throughout subtropical and tropical forests, woodlands, and savannas in South America from Venezuela to Brazil, Bolivia, Colombia and Paraguay. Blue-and-yellow macaws are also found in Mexico and are restricted to Panama in Central America.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Juniper, T. 1998. A Guide to Parrots of the World. New Haven: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Tropical e Panama to e Peru, n Bolivia, Paraguay and e Brazil.
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Blue-and-yellow macaws are from 81 to 91.5 cm long, weigh from 0.9 to 1.8 kg, and have a wing span of 104 to 114 cm. They are vibrantly colored, with blue on their backs and wings, yellow under parts, green forehead feathers, and green tips on the end of their wings. Their under-wing coverts and breast are yellow-orange and they have black beaks, throat, and legs. Their eyes are yellow and their facial area consists of bare white skin with several black feather lines around their eyes.

Range mass: 900 to 1814 g.

Range length: 81.28 to 91.44 cm.

Range wingspan: 104.14 to 114.3 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Low, R. 1983. Amazon Parrots. London: The Bailisk Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Blue-and-yellow macaws are found mainly in rainforests in swampy and riparian areas. They nest high in trees to avoid predation.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Wetlands: swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Blue-and-yellow macaws mainly eat seeds, nuts, and fruits. They use their strong beaks to break open nut shells and to crush seeds. In some cases, they consume clay found at riverbanks which allows them to digest the toxins from unripe seeds that they may have ingested.

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: herbivore (Frugivore , Granivore )

  • Ragusa-Netto, J. 2006. Ornitologia Neotropical. Dry fruits and the abundance of the Blue and yellow macaw (Ara ararauna) at a cerrado remnant in central Brazil, 17.4: 491-500.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Blue-and-yellow macaws are important seed predators in tropical forests, they may influence forest dynamics through seed predation and dispersal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known predators include harpy eagles (Harpia harpyja), hawk eagles (Nisaetus cirrhatus) and orange-breasted falcons (Falco deiroleucus) that attack while the birds are in flight. Humans are also predators because they hunt these birds for the pet trade, food, and feathers.

Known Predators:

  • harpy eagles (Harpia harpyja)
  • hawk eagles (Nisaetus cirrhatus)
  • orange-crested falcons (Falco deiroleucus)
  • humans (Homo sapiens)

  • 2010. "Bird Life International. IUCN Red List of Threatened Species." (On-line). Accessed March 17, 2010 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Blue-and-yellow macaws communicate by loud vocalizations or flock calls. They also have highly developed visual acuity. They have very complex social behavior and vocalizations, as do all macaws.

Communication Channels: visual ; tactile ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

The life span of blue-and-yellow macaws in the wild can be up to 50 years while their breeding age ranges from 30 to 35 years. They can also live up to 50 years in captivity.

Typical lifespan

Status: wild:
30 to 35 years.

Typical lifespan

Status: captivity:
30 to 35 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43 years (captivity) Observations: There are anecdotal records of animals kept as pets living over 50 years but none have been confirmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Blue-and-yellow macaws form monogamous pairs that mate for life.

Mating System: monogamous

Blue-and-yellow macaws reach sexual maturity at 3 to 4 years of age. Their breeding season is during the first half of the year and they breed about every 1 to 2 years. Nests are found high up in tall trees, mainly in cavities already made by other animals. Females lay 2 to 3 eggs and incubate them for 24 to 28 days, after which the young hatch blind and featherless. After 10 days the young begin to develop feathers. Within 3 months fledglings become independent.

Breeding interval: Blue-and-yellow macaws breed every 1 to 2 years.

Breeding season: Blue-and-yellow macaws breed from January through July.

Range eggs per season: 2 to 3.

Range time to hatching: 24 to 28 days.

Range time to independence: 10 (low) days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Blue-and-yellow macaw males and females care for their young through providing for them and protecting them. During their first week after hatching, only the female will feed the young through regurgitation, afterwards the male will also feed the young. Both parents show extreme aggression towards intruders in order to protect their young.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Juniper, T. 1998. A Guide to Parrots of the World. New Haven: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ara ararauna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGTACCGCCCTAAGCCTACTCATCCGTGCAGAACTCGGTCAACCAGGGACCCTCCTAGGAGACGACCAGATCTATAATGTAGTTGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATGGTAATGCCAATCATGATTGGAGGATTTGGGAACTGACTAGTCCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTATTGGCCTCCTCTACAGTAGAAGCAGGTGCTGGTACGGGCTGAACAGTCTACCCCCCCTTGGCCGGAAATCTGGCTCATGCTGGGGCATCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGAGTGTCCTCCATTCTAGGGGCAATCAACTTTATTACCACAGCCATCAACATAAAACCACCTGCACTATCACAATACCAAACCCCACTATTTGTCTGATCCGTCCTAATCACAGCCGTATTACTTCTACTATCCTTGCCAGTCCTAGCTGCTGGAATCACTATGCTCCTTACAGATCGTAACCTAAATACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAGTCCTGTACCAACACCTCTTCTGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ara ararauna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5