Overview

Brief Summary

The Blue-and yellow Macaw (Ara ararauna) is a very large parrot that is ultramarine blue above and mostly golden yellow below with a long tail, a large black bill, and a bare white facial patch on each side of its head with narrow lines of black feathers. The very similar (but far rarer) Blue-throated Macaw (Ara glaucogularis) has a broadly blue throat, leaving just a stripe of yellow going up each side of the neck.

Blue-and-yellow Macaws occur from eastern Panama and the tropical lowlands of South America to southeastern Brazil, Bolivia, and, at least formerly, Paraguay (they formerly occurred on Trinidad as well, but were extinct there by around 1970). They are found in wooded country, often near water. They sometimes forage in more open country, coming to the ground to feed on fallen fruits. These are gregarious, often noisy birds, usually seen in pairs, family parties, or flocks of up to 25 (or even more) individuals. They feed on a range of fruits (especially palm fruits), nuts, leafbuds, etc. Large numbers may congegate at certain riverbank locations, often with other parrot species, to ingest the mineral-rich soils exposed there. Blue-and-yellow Macaws nest high up in cavities in dead palms.

Although still common over much of their range, in other areas Blue-and-yellow Macaws have been extirpated or are currently threatened or endangered.

(Collar 1997 and references therein; Juniper and Parr 1998 and references therein)

  • Collar, N.J. 1997. Blue-and-yellow Macaw (Ara ararauna). P. 420 in: del Hoyo, J., Elliott, A., and Sargatal, J., eds. Handbook of the Birds of the World. Volume 4. Sandgrouse to Cuckoos. Lynx Edicions, Barcelona.
  • Juniper, T. and M. Parr. 1998. Parrots: A Guide to Parrots of the World. Yale University Press, New Haven, Connecticut.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Leo Shapiro

Supplier: Leo Shapiro

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Geographic Range

Ara ararauna (blue-and-yellow macaws) can be found throughout subtropical and tropical forests, woodlands, and savannas in South America from Venezuela to Brazil, Bolivia, Colombia and Paraguay. Blue-and-yellow macaws are also found in Mexico and are restricted to Panama in Central America.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Juniper, T. 1998. A Guide to Parrots of the World. New Haven: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

Range Description

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Tropical e Panama to e Peru, n Bolivia, Paraguay and e Brazil.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Blue-and-yellow macaws are from 81 to 91.5 cm long, weigh from 0.9 to 1.8 kg, and have a wing span of 104 to 114 cm. They are vibrantly colored, with blue on their backs and wings, yellow under parts, green forehead feathers, and green tips on the end of their wings. Their under-wing coverts and breast are yellow-orange and they have black beaks, throat, and legs. Their eyes are yellow and their facial area consists of bare white skin with several black feather lines around their eyes.

Range mass: 900 to 1814 g.

Range length: 81.28 to 91.44 cm.

Range wingspan: 104.14 to 114.3 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

  • Low, R. 1983. Amazon Parrots. London: The Bailisk Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Blue-and-yellow macaws are found mainly in rainforests in swampy and riparian areas. They nest high in trees to avoid predation.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: rainforest

Wetlands: swamp

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Food Habits

Blue-and-yellow macaws mainly eat seeds, nuts, and fruits. They use their strong beaks to break open nut shells and to crush seeds. In some cases, they consume clay found at riverbanks which allows them to digest the toxins from unripe seeds that they may have ingested.

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: herbivore (Frugivore , Granivore )

  • Ragusa-Netto, J. 2006. Ornitologia Neotropical. Dry fruits and the abundance of the Blue and yellow macaw (Ara ararauna) at a cerrado remnant in central Brazil, 17.4: 491-500.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Ecosystem Roles

Blue-and-yellow macaws are important seed predators in tropical forests, they may influence forest dynamics through seed predation and dispersal.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Known predators include harpy eagles (Harpia harpyja), hawk eagles (Nisaetus cirrhatus) and orange-breasted falcons (Falco deiroleucus) that attack while the birds are in flight. Humans are also predators because they hunt these birds for the pet trade, food, and feathers.

Known Predators:

  • 2010. "Bird Life International. IUCN Red List of Threatened Species." (On-line). Accessed March 17, 2010 at www.iucnredlist.org.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Blue-and-yellow macaws communicate by loud vocalizations or flock calls. They also have highly developed visual acuity. They have very complex social behavior and vocalizations, as do all macaws.

Communication Channels: visual ; tactile ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

The life span of blue-and-yellow macaws in the wild can be up to 50 years while their breeding age ranges from 30 to 35 years. They can also live up to 50 years in captivity.

Typical lifespan

Status: wild:
30 to 35 years.

Typical lifespan

Status: captivity:
30 to 35 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 43 years (captivity) Observations: There are anecdotal records of animals kept as pets living over 50 years but none have been confirmed.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Blue-and-yellow macaws form monogamous pairs that mate for life.

Mating System: monogamous

Blue-and-yellow macaws reach sexual maturity at 3 to 4 years of age. Their breeding season is during the first half of the year and they breed about every 1 to 2 years. Nests are found high up in tall trees, mainly in cavities already made by other animals. Females lay 2 to 3 eggs and incubate them for 24 to 28 days, after which the young hatch blind and featherless. After 10 days the young begin to develop feathers. Within 3 months fledglings become independent.

Breeding interval: Blue-and-yellow macaws breed every 1 to 2 years.

Breeding season: Blue-and-yellow macaws breed from January through July.

Range eggs per season: 2 to 3.

Range time to hatching: 24 to 28 days.

Range time to independence: 10 (low) days.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Blue-and-yellow macaw males and females care for their young through providing for them and protecting them. During their first week after hatching, only the female will feed the young through regurgitation, afterwards the male will also feed the young. Both parents show extreme aggression towards intruders in order to protect their young.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Juniper, T. 1998. A Guide to Parrots of the World. New Haven: Yale University Press.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ara ararauna

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 9 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

TGGTACCGCCCTAAGCCTACTCATCCGTGCAGAACTCGGTCAACCAGGGACCCTCCTAGGAGACGACCAGATCTATAATGTAGTTGTCACAGCCCATGCCTTTGTAATAATCTTCTTCATGGTAATGCCAATCATGATTGGAGGATTTGGGAACTGACTAGTCCCCCTTATAATTGGTGCCCCCGACATAGCATTCCCACGCATAAACAATATAAGCTTCTGACTACTTCCCCCATCCTTCCTCCTCCTATTGGCCTCCTCTACAGTAGAAGCAGGTGCTGGTACGGGCTGAACAGTCTACCCCCCCTTGGCCGGAAATCTGGCTCATGCTGGGGCATCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGAGTGTCCTCCATTCTAGGGGCAATCAACTTTATTACCACAGCCATCAACATAAAACCACCTGCACTATCACAATACCAAACCCCACTATTTGTCTGATCCGTCCTAATCACAGCCGTATTACTTCTACTATCCTTGCCAGTCCTAGCTGCTGGAATCACTATGCTCCTTACAGATCGTAACCTAAATACCACATTCTTCGACCCCGCTGGAGGAGGAGACCCAGTCCTGTACCAACACCTCTTCTGAT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ara ararauna

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ara ararauna is considered least concern by the IUCN due to their large geographic range. The population trend is declining but not enough to reach vulnerable status. Populations are considered greater than 10,000 adult macaws and a decline of less than 10% over the past 10 years is evident. Ara ararauna is extinct in Trinidad and Tobago but conservation efforts have reintroduced these macaws on Trinidad. Between 1999 and 2004 wild caught macaws from Guyana were brought to Trinidad and placed into pre-release flight cages. Fourteen birds were released, 9 survived and produced 12 chicks within three mating seasons. Upon a second release, 12 macaws acclimated into pre-existing groups and produced 14 chicks within three mating seasons. Habitat degradation in South America from pollution, development, and logging is also affecting populations of blue and yellow macaws.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

  • Plair, B. 2008. Ornitologia Neotropical. Behavioral monitoring, of Blue-and-yellow Macaws (Ara ararauna) reintroduced to the Nariva Swamp, Trinidad, 19: 113-122.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'uncommon' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The species has been heavily traded: since 1981, when it was listed on CITES Appendix II, 55,531 wild-caught individuals have been recorded in international trade (UNEP-WCMC CITES Trade Database, January 2005).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
The species is listed under CITES Appendix II.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Although these birds are rewarding companions, their large size, behavioral complexity, and longevity requires a large home and extensive commitment. Their removal from native habitats also often results in deaths of parents in order to obtain fledglings and destruction of important nesting trees. The illegal pet trade results in much destruction.

Negative Impacts: household pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Blue-and-yellow macaws are popular as pets because they are beautiful, behaviorally complex, and have the ability to mimic words and sounds. They are intelligent, social animals who are great companions and become close to their owners, if handled well.

Positive Impacts: pet trade ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Blue-and-yellow macaw

The blue-and-yellow macaw (Ara ararauna), also known as the blue-and-gold macaw, is a large South American parrot with blue top parts and yellow under parts. It is a member of the large group of Neotropical parrots known as macaws. It inhabits forest (especially varzea, but also in open sections of terra firme or non-flooded forest) and woodland of tropical South America.

There has been a small breeding population in Miami-Dade County, Florida, since the middle 1980s.[2]

They are popular in aviculture because of their striking color, ability to talk, ready availability in the marketplace, and close bonding to humans.

Taxonomy[edit]

The blue-and-Yellow macaw (Ara ararauna, Linnaeus 1758) is a member of the genus Ara (Lacepede 1799), one of six genera of Central and South American macaws. Protonym: Psittacus ararauna. The species name is derived from Tupi Ara onamatopoeia macao: macaw; Tupi arara: parrot +una: dark or black, hence "dark parrot/macaw".

Description[edit]

These birds can reach 76 to 86 cm (30 to 34 in) long and weigh 900 to 1500 grams (1.9 to 3.3 lbs), making it one of the larger members of its family. They are vivid in appearance with blue wings and tail, dark blue chin, golden under parts, and a green forehead. Beaks are black. The naked face is white, turning pink in excited birds, and lined with small black feathers.

There is little variation in plumage across the range. Some birds have a more orangey or "butterscotch" underside color, particularly on the breast. This was often seen in Trinidad birds and others of the Caribbean area. The blue-and-yellow macaw uses its powerful beak for breaking nutshells, and also for climbing up and hanging from trees.

Behavior[edit]

Macaws in the wild can be very aggressive, but as babies they can be very playful.

Feeding[edit]

Macaws primarily eat nuts, seeds and fruits. Occasionally they consume clay at riverbeds, in order to filter out toxins obtained from any unripe nuts they have consumed.

Breeding[edit]

The blue-and-yellow macaw generally mates for life. They nest almost exclusively in dead palms and most nests are in Mauritia flexuosa palms. The female typically lays two or three eggs. The female incubates the eggs for about 28 days. One chick is dominant and gets most of the food; the others perish in the nest. Chicks fledge from the nest about 97 days after hatching. The male bird's color signals readiness for breeding. The brighter and bolder the colors the better the chance of getting a mate is.[3]

Distribution and habitat[edit]

This species occurs in Venezuela and south to Peru, Brazil, Bolivia, and Paraguay. The range extends slightly into Central America, where it is restricted to Panama. The species' range formerly included Trinidad, but it became extinct there by 1970 as a result of human activities. Between 1999 and 2003, wild caught blue-and-gold macaws were translocated from Guyana to Trinidad, in an attempt to reestablish the species in a protected area around Nariva swamp.

Conservation and threats[edit]

The blue-and-yellow macaw is on the verge of being extirpated in Paraguay, but it still remains widespread and fairly common in a large part of mainland South America. The species is therefore listed as Least Concern by BirdLife International. It is listed on CITES Appendix II, trade restricted.

Aviculture[edit]

At Walsrode Bird Park, Germany

Blue-and-yellow macaws are popular as pets because of their vivid appearance and ability as a talking bird; however, their large size makes accommodation problematic, and they tend to require more effort and knowledge from owners than more traditional pets such as cats or dogs. They are very intelligent and social birds that bond very closely to owners, however, so for people who are able to provide for their needs, they make great and loving companion parrots.

Even the most well-tended blue-and-yellow macaw will "scream" and make other loud noises. Loud vocalizations, especially "flock calls", and destructive chewing are natural parts of their behavior and should be expected in captivity. Due to their large size, they also require plentiful space in which to fly around. According to World Parrot Trust, an enclosure for a blue-and-yellow macaw should, if possible, be at least 50 feet (15 metres) in length.[4]

Given their intelligence, blue-and-yellow macaws can be taught to do tricks once they have gained enough trust from their owners.

They require a varied diet; a seed only diet will lead to health problems such as vitamin deficiency. An example of a good diet would be a quality pelleted mix, in conjunction with a mix featuring seed, nuts, and dried fruits, with fresh vegetables (greens and roots) and fruits fed regularly; furthermore, it is quite common (and appreciated by the parrot) to partake with their human owners of safe foods like pasta, bread, etc. It is important to avoid foods with high fat content (generally) while striving to provide a wide variety of foods. There are some foods which are toxic to birds and parrots as a group. Cherries and most other Rosaceae pits and seeds, avocados, chocolate, and caffeine are among the foods toxic to parrots. Chocolate and caffeine are not metabolized by birds the same way they are in humans. Rosaceae seeds contain cyanogenic glycosides, and avocados contain persin which are both toxic compounds to birds. Safe foods include oranges, apples, grapes, peanuts, walnuts, and sunflower seeds.

Gallery[edit]

See also[edit]

References[edit]

  1. ^ BirdLife International (2012). "Ara ararauna". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Krishnan, Karunya. "Macaws on campus 'awesome' but noisy." The Miami Hurricane. 2009.
  3. ^ Alderton, David (2003). The Ultimate Encyclopedia of Caged and Aviary Birds. London, England: Hermes House. p. 235. ISBN 1-84309-164-X. 
  4. ^ "Blue and Gold Macaw (Ara ararauna) | Parrot Care". World Parrot Trust. Retrieved 28 January 2010. 

Further reading[edit]

  • Doane, Bonnie Munro & Qualkinbush, Thomas (1994): My parrot, my friend : an owner's guide to parrot behavior. Howell Book House, New York. ISBN 0-87605-970-1
  • ffrench, Richard; O'Neill, John Patton & Eckelberry, Don R. (1991): A guide to the birds of Trinidad and Tobago (2nd edition). Comstock Publishing, Ithaca, N.Y.. ISBN 0-8014-9792-2
  • Hilty, Steven L. (2003): Birds of Venezuela. Christopher Helm, London. ISBN 0-7136-6418-5
  • Forshaw, J.M. Parrots of the World. New Jersey. T.F.H. Publications Inc. 1978.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!