Overview

Brief Summary

Biology

The red-rumped parrot, which is most active at dawn and dusk (4), feeds on the seeds of grasses and herbs, shoots, leaves, blossoms and some fruits (2). To enable it to feed easily on seed heads, it cleverly perches on the stem of the plant until its weight bends the stem to the ground, which allows the parrot to peck up the seeds without difficulty (4). Breeding takes place between August and January, when the red-rumped parrot builds a nest in a hollow tree limb or hole in the trunk, often near water, or on fence posts or in farm and suburban buildings. It lays between four and eight eggs and incubates the clutch for 19 days. The young hatchlings remain in the nest for around four weeks (2). While it is often seen in pairs or small flocks, outside of the breeding season groups consisting of over 100 individuals may occur (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

This parrot is named after its most distinctive feature: the bright red patch of feathers on its rump. Its striking rump contrasts with the rest of the plumage, which on males is largely grass green and on females is a duller brownish-green. The underparts also differ slightly between the sexes; the male has a yellow belly shading to white under the tail, while females are yellowish-olive below (2). The more attractively coloured male may also have blue, grey and black shades in its wing feathers, a blue tinge to its forehead and lower cheeks, and a dark green tail, tipped black and edged in white. Immature red-rumped parrots are similar to females in appearance, but duller (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Two subspecies of the red-rumped parrot are recognised: Psephotus haematonotus haematonotus occurs in south-east Australia, from southern Queensland to Victoria and eastern South Australia, while Psephotus haematonotus caeruleus is found in the Lake Eyre region of South Australia, south-western Queensland and north-western New South Wales (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The red-rumped parrot inhabits open and riverine woodland, grassland, farmland, occasionally mangroves, and urban areas such as roadsides, parks and golf courses (2) (4). It occurs up to an elevation of around 1,100 metres (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12.2 years (captivity) Observations: One specimen lived 12.2 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psephotus haematonotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.

Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen.

Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAATCTTTGGTGCATGAGCCGGCATAATCGGGACTGCCTTAAGCCTACTAATTCGAGCAGAACTAGGCCAACCAGGAACGCTCCTAGGAGACGACCAAATCTACAATGTAATCGTAACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGAGGATTCGGAAACTGATTAGTCCCACTTATAATCGGAGCCCCCGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTCCTCCTACTAGCCTCATCCACAGTAGAAGCAGGAGCCGGTACAGGATGAACAGTATACCCCCCTTTAGCCGGAAATCTGGCCCACGCTGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTATCCTCCATCCTCGGAGCAATCAACTTCATTACCACTGCAATTAATATGAAACCACCAGCCCTATCACAATACCAAACCCCACTATTCGTTTGATCCGTCCTAATCACAGCCGTACTTCTCCTCCTATCTTTACCAGTATTAGCTGCTGGCATCACCATACTTCTTACTGACCGCAACCTAAACACTACCTTCTTCGATCCTGCTGGCGGAGGAGACCCAATTCTTTACCAACACCTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Psephotus haematonotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5