Overview

Brief Summary

Biology

The red-rumped parrot, which is most active at dawn and dusk (4), feeds on the seeds of grasses and herbs, shoots, leaves, blossoms and some fruits (2). To enable it to feed easily on seed heads, it cleverly perches on the stem of the plant until its weight bends the stem to the ground, which allows the parrot to peck up the seeds without difficulty (4). Breeding takes place between August and January, when the red-rumped parrot builds a nest in a hollow tree limb or hole in the trunk, often near water, or on fence posts or in farm and suburban buildings. It lays between four and eight eggs and incubates the clutch for 19 days. The young hatchlings remain in the nest for around four weeks (2). While it is often seen in pairs or small flocks, outside of the breeding season groups consisting of over 100 individuals may occur (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Description

This parrot is named after its most distinctive feature: the bright red patch of feathers on its rump. Its striking rump contrasts with the rest of the plumage, which on males is largely grass green and on females is a duller brownish-green. The underparts also differ slightly between the sexes; the male has a yellow belly shading to white under the tail, while females are yellowish-olive below (2). The more attractively coloured male may also have blue, grey and black shades in its wing feathers, a blue tinge to its forehead and lower cheeks, and a dark green tail, tipped black and edged in white. Immature red-rumped parrots are similar to females in appearance, but duller (2).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Distribution

Range

Two subspecies of the red-rumped parrot are recognised: Psephotus haematonotus haematonotus occurs in south-east Australia, from southern Queensland to Victoria and eastern South Australia, while Psephotus haematonotus caeruleus is found in the Lake Eyre region of South Australia, south-western Queensland and north-western New South Wales (2) (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

The red-rumped parrot inhabits open and riverine woodland, grassland, farmland, occasionally mangroves, and urban areas such as roadsides, parks and golf courses (2) (4). It occurs up to an elevation of around 1,100 metres (2)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 12.2 years (captivity) Observations: One specimen lived 12.2 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Psephotus haematonotus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There is 1 barcode sequence available from BOLD and GenBank.   Below is the sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen.  Other sequences that do not yet meet barcode criteria may also be available.

CCTCTACCTAATCTTTGGTGCATGAGCCGGCATAATCGGGACTGCCTTAAGCCTACTAATTCGAGCAGAACTAGGCCAACCAGGAACGCTCCTAGGAGACGACCAAATCTACAATGTAATCGTAACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTAATACCAATCATAATCGGAGGATTCGGAAACTGATTAGTCCCACTTATAATCGGAGCCCCCGATATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTCCCCCCATCTTTCCTCCTCCTACTAGCCTCATCCACAGTAGAAGCAGGAGCCGGTACAGGATGAACAGTATACCCCCCTTTAGCCGGAAATCTGGCCCACGCTGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTCCACCTAGCAGGTGTATCCTCCATCCTCGGAGCAATCAACTTCATTACCACTGCAATTAATATGAAACCACCAGCCCTATCACAATACCAAACCCCACTATTCGTTTGATCCGTCCTAATCACAGCCGTACTTCTCCTCCTATCTTTACCAGTATTAGCTGCTGGCATCACCATACTTCTTACTGACCGCAACCTAAACACTACCTTCTTCGATCCTGCTGGCGGAGGAGACCCAATTCTTTACCAACACCTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Psephotus haematonotus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 1
Specimens with Barcodes: 2
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Status

Classified as Least Concern (LC) on the IUCN Red List 2007 (1) and listed on Appendix II of CITES (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is reported to be common to abundant throughout its range (del Hoyo et al. 1997).

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Considered to be a common bird that is abundant in some parts of its range, the red-rumped parrot is not believed to be threatened with extinction (1) (2), although there is some evidence that numbers may be declining slightly (1). The reasons behind this are not clear.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Conservation

As the red-rumped parrot is found in the pet trade (4), this species is listed on Appendix II of the Convention on International Trade in Endangered Species (CITES) meaning that any international trade in this species should be carefully controlled (3).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Red-rumped Parrot

The Red-rumped Parrot (Psephotus haematonotus), also known as the Red-backed Parrot or Grass Parrot, is a common bird of south-eastern Australia, particularly in the Murray-Darling Basin.

Taxonomy[edit]

The Red-rumped Parrot was described by John Gould in 1838 and is the type species for the genus Psephotus. It was long presumed to be closely related to the Mulga Parrot, however analysis of multiple genetic material shows it to be an early offshoot of a group containing the genera Platycercus and Barnardius.[2]

Description[edit]

Red-rumped Parrots are slim, elegant, moderate-sized parrots approximately 28 cm (11 in) in length. The male's plumage is a bright emerald-green with yellow underparts, a brick-red rump and blue highlights on the wings and upper back. The female's plumage is less vibrant, with pale olive underparts, dull green wings and back and blue-black wingtips. The characteristic red rump is only found in the male.

Behavior[edit]

A pair in suburban Sydney, Australia

Red-rumped Parrots can be found in pairs or flocks in open country with access to water. They avoid the coast and the wetter, more heavily wooded areas. Clearing of large tracts of forest and the provision of water for stock has probably extended their range. They are often seen in suburban parks and gardens. Their green plumage provides such a good camouflage in ankle length grasses that they can hide quite effectively until the viewer is only 10–20 metres away.

They spend a great deal of time feeding on the ground, and often call to one another with an attractive chee chillip chee chillip.

Breeding[edit]

Like many parrots, Red-rumped Parrots nest in tree hollows or similar places, including fenceposts and stumps. They lay 3-6 white eggs, Breeding usually takes place in spring (August to January), however, in the dryer inland areas, breeding can occur at any time of year in response to rainfall.

Aviculture[edit]

Female (left) and male (right) at Eastern Creek, New South Wales, Australia

Red rumps are bred easily in captivity if provided with necessary flight space and a large nesting box. Breeders usually use peat and wood shavings as bedding for the nests, birds like to arrange the beds to their likings. As soon as mating has occurred the hen will deposit 4 to 7 eggs which she will brood for about 20 days. Red rump hens will not go out of the nest box whilst on eggs and not even human checking will make them leave their eggs alone. The eggs will hatch around 30 days after and take care to remove the chicks as soon as they are fledged or else the cock may attack his own offspring. One-year-old birds are already able to breed. Incubation from the second egg onwards. The brooding hen is fed by her partner outside the nest.

Mutuations are created by aviculturist in red rumped parrots. Yellow Red rumped parrots are readily available in the market.

Housing[edit]

Red-rumped parrots do well in aviaries and cages. They don't like to be in crowded spaces and will sometimes be aggressive towards other birds if they don't have enough space. Red-rumped parrots can also be hand reared, provided that they have a large cage and are taken out of their cage on a daily basis to prevent boredom, as it may result in the parrot pulling out its feathers to occupy itself.

Lifespan[edit]

In captivity, if properly cared for, these birds will live from 15 to 25 years.

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!