Overview

Distribution

Range

Irregularly abundant near water in interior of Australia.

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Geographic Range

Cockatiels are native to the Australian mainland; they are widely distributed throughout Australia, with denser populations in the southwestern region of the continent.  Cockatiels are also found in Tasmania, but are considered to have been introduced to this island accidentally.

Biogeographic Regions: australian (Native )

  • Blakers, M., S. Davies, P. Reilly. 1984. The Atlas of Australian Birds. Beaverton, OH: Melbourn University Press.
  • Kavanau, , Lee. 1987. Behavior and evolution: lovebirds, cockatiels, and budgerigars.. Los Angeles, California: Science Software Systems.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

The smallest member of the Cacatuinae subfamily (the cockatoos), with an average weight of 80 g, cockatiels slender and streamlined. Cockatiels are the only type of crested parrot that has a tail which comes to a point. This tapered tail is very long (ca. 15 cm), making up half of their length. In flight, these tail feathers spread out into a wide fan, the elevation angle of which can be adjusted by the bird to control altitude and stability.  While long-term artificial selection for mutations in color have resulted in many different color variations in pet cockatiels (from the speckled pearl mutation to the light yellow-white lutino mutation), wild cockatiels of both sexes share similar characteristics in appearance. Males exhibit dark brown to gray plumage, with patches of white bordering areas such as the upper wing when folded. Their cheeks have bright orange circular patterns, bordered by white. Females are also mainly gray, with cheek patches of a drab, burnt-orange shade, which lack a white border. Feathers in these cheek patches are modified to protect the ear and minimize flight turbulence.  The underside of the tail feathers tends to be more complex in color variation than the rest of the body, possessing distinctive bars of alternating color. Both males and females have dark brown irises and crests of approximately 5 cm. These crests, composed of several dozen feathers, adorn the top of the head and are used in communication; the angle at which the crest is held is indicative of a bird’s mood. Cockatiel coloration has resulted from natural selection to optimize camouflage while foraging on the ground. Their colorations allows them to be easily overlooked by aerial predators, especially in shady areas. Their beaks, characteristic of all parrots, have curved upper sections that come to a point. The nostrils sit atop the beak at the attachment point of the upper beak to the skull and are round. The bill is dark gray, while legs are blackish gray. Cockatiels exhibit zygodactyly, as do all parrots, they have two toes facing backwards, and two facing forwards.

Average mass: 80-90 g.

Range length: 25 to 35 cm.

Range wingspan: 40 (high) cm.

Average wingspan: 30-35 cm.

Average basal metabolic rate: 14.2 kcal per day cm^3 oxygen/hour.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes colored or patterned differently; male more colorful

Average mass: 90 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cockatiels are widely distributed through the Australian mainland, tending to prefer inland areas to coastlines. They tend to congregate in areas near bodies of freshwater and prefer generally open areas as opposed to dense forest. Thus, open woodland areas encompassed by waterways in addition to savannas bordering waterholes are optimal areas to find cockatiel flocks. Generally nomadic, cockatiels prefer Acacia seeds to other foods and densely populate areas with Acacia shrubs. (Pizzey and Knight, 1997). Cockatiels follow preditable migratory patterns in southern Australia, where weather patterns are more regular. Here, they move in groups of one hundred to one thousand (Kavanau and Lee, 1987). Cockatiels are presented with large temperature variations in their habitats, from 4.5 degrees Celsius during winter nights to heat exceeding 43 degrees Celsius in the summer (Allen and Allen, 1981). Cockatiels are secondary cavity nesters, preferring large tree hollows when building nests (typically dead eucalypts). Nest sites are usually near water, approximately one to two meters above the ground.

Range elevation: 0 to 500 m.

Average elevation: 200-500 m.

Habitat Regions: tropical

Terrestrial Biomes: savanna or grassland

  • Allen, G., C. Allen. 1981. Cockatiel Handbook. Neptune, New Jersey: TFH Publishing Co.
  • Foreshaw, J., W. Cooper. 2002. Australian Parrots 3rd edition. Melbourne, Lansdowne: Avi-Trader Publishing.
  • Pizzey, G., F. Knight. 1997. Field Guide to the Birds of Australia. Sydney, Australia: Angus and Robertson.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Cockatiels are almost exclusively ground foragers. They are zygodactylous, their long toes not only serve to wrap around perches, but also extend outward to make extremely large, stable feet for walking on the ground. While cockatiels can feed on a variety of plant and animal matter, their sharp curved beaks are adapted to maximize efficiency in shucking and consuming seeds, their food of choice. Either in pairs, small groups of 6 to 8 birds, or larger flocks of several hundred birds, cockatiels search open areas for sun-dried seeds from grasses, shrubs, and trees. Cockatiels use their tongues to rotate seeds as they use their upper beak to remove shells; they can remove a shell and consume a seed in only a few seconds. Cockatiels also remove seeds directly from branches. Cockatiels obtain water primarily from freshwater pools such as water-holes. Vulnerable to predation on the ground, they drink rapidly, usually only taking one to two sips of water, then extending their necks upwards to swallow and survey their surroundings. Cockatiels utilize metabolic water production, and can go for long amounts of time without drinking. Versatile in their feeding behavior, cockatiels can also consume softer foods, such as fruits and berries. They have also been observed to eat small ground-dwelling insects. Cockatiels remain silent during foraging.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: herbivore (Granivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Although they prefer sun-dried seeds, cockatiels can serve the role of seed-dispersers in their ecosystems when they choose to consume fresh seeds, as they are very messy eaters and scatter seeds and shells as far as four to five feet away from themselves when they eat. They can also disperse the seeds of the fruits they consume.

Cockatiels are also susceptible to bacterial infection, particularly in the liver, and in such cases harbor bacteria such as Giardia lamblia and Cryptosporidium galli, which are associated with weight loss, abnormal droppings, and mortality.

Ecosystem Impact: disperses seeds

Commensal/Parasitic Species:

  • Antunes, R., D. Simoes, A. Nakamura, M. Meireles. 2008. Natural infection with Cryptosporidium galli in Canaries (Serinus canaria), in a Cockatiel (Nymphicus hollandicus) and in Lesser Seed-Finches (Oryzoborus angolensis) from Brazil. Avian Diseases, 52: 702-705.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

Australian birds of prey are the primary predators of cockatiels. Cockatiels are mostly preyed upon from above while feeding by raptors. They are camouflaged to blend in with the ground. Other than their coloration, cockatiels have no natural defenses to predators other than their high-speed flight. Thus, cockatiels always respond to threats by aerial evasion. They also use loud, shrill vocalizations to communicate threats among each other and stay in large flocks, where many eyes can look for predators. Cockatiels can also in extreme circumstances deliver a powerful bite from their sharp beaks and well-developed jaw muscles, which can easily pierce the skin. Cockatiels bite as a last resort defense mechanism, which can be observed in nesting cockatiels confronted with an invasive predator to the nestbox.

Known Predators:

Anti-predator Adaptations: aposematic ; cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Behavior

Communication and Perception

Cockatiels are unlike some larger species of parrots in that they cannot accurately imitate the human voice, but have the ability to mimic melodies and can sing.  Cockatiels have a range of distinctive variations used to communicate moods. High-pitched chirps can be indicative of stress and, by the pitch and duration of the cry, the magnitude of the stressor can in some cases be determined. For example, cries of a lower pitch can be indicative of a mild stressor, while higher pitched cries are accompanied by flight. This indicates that a threat is severe enough to cause immediate evasion. Cockatiels can communicate over relatively large distances, as they are shrill and very loud. Other forms of vocal communication are male songs, which are prolonged calls occurring during mating periods to indicate availability and attract females. Cockatiels also express mood visually through the use of their crests. The crest is held vertically erect when the bird is startled or is alert. When content, it is generally held at roughly a 45-degree angle to the head. When agitated or threatened, the crest is held flat against the head. During flight, the crest is also laid flat against the skull, reducing wind drag. Another notable behavior is the spreading of the wings both upwards and outwards while at rest. This is typically seen in reproductive courtships by both sexes and is often used as a visual method to impress another bird.

Communication Channels: visual

Other Communication Modes: mimicry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Behavior Towards Humans

Cockatiels are very popular around the world as household pets, as they require much less maintenance than animals such as dogs or cats. They are very trainable, apart from the fact that they will chirp often in the early morning and before going to sleep. It is possible to teach them to mimic sounds, such as whistles or short songs, but they cannot replicate speech to the extent of something such as a parrot. Cockatiels will hiss when they feel threatened, and will screech when they feel lonely or angry after being accustomed to a human's presence.

Cockatiels spend a large amount of their time either sleeping or preening. After preening, they will shake their whole body and fluff out their weathers in order to show a sense of comfort/content. In order to impress, they will stretch their wings with their feet or spread their wings out to show off their wingspan. They enjoy flying, and can remain in the air for quite some time unless their wings are regularly clipped by a veterinarian. Whenever they are outside, cockatiels should be closely watched as their unusual chirps will attract many types of predators such as crows.

Creative Commons Attribution 3.0 (CC BY 3.0)

Supplier: Tom Brodowski

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Life Expectancy

Lifespan/Longevity

Wild cockatiels have a lifespan of 10 to 14 years. Those in captivity can live much longer; extensive research in cockatiel nutrition and metabolic requirements have allowed for diet optimization to achieve optimum health. Captive cockatiels can live for up to 25 years, with the oldest on record reaching an incredible 36 years old. Diet and environmental factors play essential roles in cockatiel lifespan.

Range lifespan

Status: captivity:
36 (high) years.

Average lifespan

Status: wild:
10-14 years.

Average lifespan

Status: captivity:
15-25 years.

Average lifespan

Status: captivity:
35 years.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 35 years (captivity) Observations: One specimen lived for 35 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Cockatiels are monogamous and form relationships with a mate early on. These bonds serve for more than reproductive purposes - pairs stay together and remain loyal to one another throughout the entire year. Because cockatiels remain paired throughout the year, they readily proceed to breeding without expending energy to find a suitable mate. Before mating begins, there are several ritualistic behaviors that both sexes exhibit. Vocalization plays an important role in communicating readiness in both sexes; females emit muffled peeps while holding their tail feathers erect to signify readiness, while males are much more aggressive in their vocalizations, whistling unique mating calls referred to as songs. Males accompany these songs with a variety of physical behaviors, including a strut-like walk, holding of the wings erect and away from the body, and rapid beak-pounding to draw attention. One of the behaviors observed in male cockatiels just prior to mating is the observation of the nest cavity, a preselected hollow in which to lay eggs. Males inspect nest cavity for threats before females first enter them, and often males will repeatedly jump in and out of boxes to signify safety.

Mating System: monogamous ; cooperative breeder

Cockatiel breeding is tied to seasonal changes, the most important being rainfall. Large spring rainfalls assure plentiful food supplies and usually trigger mating events. Interesting field observations to note are the behaviors of cockatiels before large spring rain storms: “[W]hen a thick black rain cloud darkens the sky, cockatiels call excitedly to one another as they fly from perch to perch. The excitement of these events usually elicits a frenzy of sexual display by the males…who search for nestholes accompanied by the hen (Smith, 1978).” As secondary cavity nesters, cockatiels nest in large tree hollows, where pairs typically claim an entire tree. They prefer dead eucalypts approximately 2 meters above the ground and close to a source of freshwater; these snags riddled with cracks are favored as they are less likely to become flooded with water during periods of excess rainfall. Upon obtaining an adequate nest hole and after safety inspections by the male, mating can commence. Once stored in the oviduct, cockatiel spermatozoa are long-lived, allowing egg fertilization up to a month after disposition. Females oviposit as soon as four days after finding a nest hole, and clutch sizes generally average from four to seven eggs, which are laid every other day. Female cockatiels are indeterminate egg-layers, having the ability to replace lost or broken eggs with more. Hence, if nutritional demands are sustained, females can continue to lay eggs until a clutch of appropriate size is established. Eggs are incubated for 17 to 23 days and chicks are independent and leave the nest by five weeks, though sexual maturity is not reached until 13 months in males and 18 months in females.

Breeding interval: Cockatiels breed once yearly with their mates, usually triggered by rainfall.

Breeding season: Breeding typically occurs from August to December.

Range eggs per season: 4 to 7.

Average eggs per season: 5.

Range time to hatching: 17 to 23 days.

Average birth mass: 4-6 g.

Range fledging age: 3 to 5 weeks.

Average time to independence: 4-5 weeks.

Average age at sexual or reproductive maturity (female): 18 months.

Average age at sexual or reproductive maturity (male): 13 months.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization

Cockatiels have a strong parental drive and both parents share responsibilities in the hatching and raising of chicks. Both male and female chicks have unique roles in incubating eggs; males incubate eggs from early morning to late afternoon, while females incubate throughout the entire night. Males stand outside the nest cavity near the entrance at nightfall. When chicks hatch, both parents participate in allofeeding, the process through which food is passed from one bird to another, but the male mainly carries this role. This feeding process is usually initiated 2 h post-hatch. Cockatiels rarely abandon chicks; in captive studies many would not leave the nest box unless physically removed by researchers. As many duties are shared by both parents, parental compatibility is essential in cockatiels; a study by Spoon and Milliam (2006) suggests that this compatibility correlates to many aspects of reproductive success, including clutch size and number of chicks raised to independence.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Male, Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Protecting: Female); pre-independence (Provisioning: Male, Protecting: Male, Female)

  • Kavanau, , Lee. 1987. Behavior and evolution: lovebirds, cockatiels, and budgerigars.. Los Angeles, California: Science Software Systems.
  • Martin, S., R. Millam. 1995. Nest box selection by floor laying and reproductively naive captive cockatiels. Applied Animal Science, 43: 95-109.
  • Millam, J., B. Zhang, E. El Halawani. 1996. Egg production of cockatiels (Nymphicus hollandicus) is influenced by number of eggs in nest after incubation begins. General and Comparative Endocrinology, 101: 205-210.
  • Smith, G. 1978. Encyclopedia of Cockatiels. Neptune, New Jersey: TFS Publishing.
  • Spoon, T., J. Milliam. 2006. The importance of mate behavioral compatibility in parenting and reproductive success by cockatiels, Nymphicus hollandicus. Animal Physiology, 71: 315-326.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Nymphicus hollandicus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACTCTAAACCGATGACTATTCTCAACCAATCACAAAGACATTGGCACCCTCTACTTAATCTTTGGTGCATGAGCTGGCATAATTGGCACCGCCCTAAGCCTACTCATTCGCGCAGAACTTGGTCAACCAGGAACTCTACTAGGAGACGACCAAATCTACAATGTAATCGTCACTGCTCATGCCTTTGTAATAATCTTCTTCATGGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTAGTCCCACTTATAATTGGCGCCCCCGACATAGCGTTCCCCCGTATAAACAACATAAGCTTCTGACTACTCCCTCCCTCCTTCCTCCTCCTACTAGCCTCCTCCACAGTAGAAGCTGGCGCTGGTACAGGATGAACCGTCTACCCCCCCTTAGCCGGAAACCTAGCCCATGCCGGAGCTTCGGTAGACCTAGCCATCTTTTCCCTCCACCTAGCAGGTGTATCCTCCATTCTAGGAGCAATCAACTTCATCACCACCGCTATCAACATAAAACCCCCCGCCCTATCACAATACCAAACCCCACTATTTGTCTGATCCGTCCTCATCACAGCCGTACTACTCCTACTATCCCTCCCAGTCCTAGCTGCTGGTATCACTATGCTCCTCACAGATCGCAACCTAAACACCACATTCTTCGACCCTGCAGGGGGAGGAGATCCAATCCTGTACCAACACCTCTTCTGATTCTTCGGACACCCAGAAGTATACATCCTTATCCTCCCAGGATTTGGAATTATTTCACACGTAGTAGCCTACTACGCAGGCAAGAAAGAACCATTTGGCTACATAGGCATAGTATGGGCTATGCTATCTATTGGATTCCTAGGATTCATTGTATGGGCTCACCACATATTTACAGTAGGAATAGACGTAGACACTCGAGCGTACTTCACATCCGCCACCATAATCATTGCCATCCCTACCGGAATCAAAGTCTTCAGCTGACTAGCCACACTACACGGTGGAACTATCAAATGAGACCCCCCAATACTATGAGCCTTAGGATTCATCTTCTTATTCACCATTGGAGGACTCACAGGAATTGTTCTAGCAAACTCCTCATTAGACATCGCCCTACATGACACATATTACGTAGTAGCACACTTCCACTACGTCCTCTCAATAGGTGCCGTATTTGCCATCCTGGCAGGATTCACCCACTGATTCCCCCTATTCACTGGATTCACCCTCCACCAAACATGGGCTAAAGCCCACTTTGGAGTCATATTTATTGGTGTAAACCTCACCTTCTTCCCCCAACACTTCCTTGGACTAGCAGGCATACCACGACGATACTCAGACTACCCAGATGCCTACACACTATGAAACACCCTCTCATCCATCGGATCCCTAATCTCAATAACAGCCGTAATCATACTAACCTTCATCATCTGAGAAGCCTTTGCCTCCAAACGAAAAATCCCACAACCAGAACTAACCTCCACCAACATCGAGTGAATCCACGGCTGCCCACCTCCATACCACACCTTCGAAGAACCCGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Nymphicus hollandicus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 13
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be stable, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Cockatiels have a very large range and densely populate the Australian mainland. The exact population has never been quantified for this reason and they are not considered threatened currently.

US Migratory Bird Act: no special status

US Federal List: no special status

CITES: appendix ii

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but the species is described as abundant (del Hoyo et al. 1997).

Population Trend
Stable
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

Cockatiels can be regarded as pests to agricultural industries in Australia, where flocks of several thousand have been known to raid crop fields, particularly fields of sorghum, millet, wheat, and sunflowers. There have been open seasons on cockatiels in Queensland, Australia. They are generally protected by law and are sometimes dealt with by the use of pesticides to deter them from fields.

Negative Impacts: crop pest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Economic Importance for Humans: Positive

Cockatiels are popular pets, the second most popular bird after budgerigars. Through selective breeding, dozens of color mutations have been achieved; perhaps the most extreme of these is the lutino variation, in which the cockatiel is completely white or light yellow, with only its bright orange cheek patches accentuating this uniform color. Cockatiels bred selectively can sell for high prices. Societies such as the National Cockatiel Society host regular shows and exhibitions in which cockatiel breeders can showcase their birds and compete for prizes. Many students also benefit from cockatiels by conducting research in university settings. The Psittacine Research Group in California is one group that has an established cockatiel colony devoted to research. This laboratory has provided students with research experience, as well as valuable data to the scientific community concerning cockatiel nutrition and behavior.

Positive Impacts: pet trade ; research and education

  • Roudybush, T., C. Grau. 1991. Cockatiel (Nymphicus hollandicus) Nutrition. The Journal of Nutrition, 121: 206.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Cockatiel

The cockatiel (Nymphicus hollandicus), also known as the Quarrion and the Weiro, is a member of the cockatoo family endemic to Australia. They are prized as a household pet and companion parrot throughout the world and are relatively easy to breed. As a caged bird, cockatiels are second in popularity only to the budgerigar.[2]

The cockatiel is the only member of the genus Nymphicus. It was previously considered a crested parrot or small cockatoo; however, more recent molecular studies have assigned it to its own unique cockatoo subfamily Nymphicinae. It is, therefore, now classified as the smallest of the Cacatuidae (Cockatoo family). Cockatiels are native to Australia, and favour the Australian wetlands, scrublands, and bush lands.

Taxonomy and etymology[edit]

Originally described by Scottish writer and naturalist Robert Kerr in 1793 as Psittacus hollandicus, the cockatiel (or cockateel) was moved to its own genus, Nymphicus, by Wagler in 1832. Its genus name reflects the experience of one of the earliest groups of Europeans to see the birds in their native habitat; the travellers thought the birds were so beautiful that they named them after mythical nymphs. The specific name hollandicus refers to New Holland, a historic name for Australia.

Its biological relationship had long been argued; it is now classified into a monotypic subfamily Nymphicinae but had sometimes in the past been misclassified among the Platycercinae, the broad-tailed Parakeets. This issue has now been settled with molecular studies. A 1984 study of protein allozymes signalled its closer relationship to cockatoos than to parrots,[3] and Mitochondrial 12S rRNA sequence data[4] places it amongst the Calyptorhynchinae (Dark Cockatoos) subfamily. The unique, Parakeet (meaning LONG-tailed Parrot) morphological feature is a consequence of the decrease in size and accompanying change of ecological niche.

Sequence analysis of intron 7 of the nuclear ?-fibrinogen gene, on the other hand, indicates that it may yet be distinct enough as to warrant recognition of the Nymphicinae rather than inclusion of the genus in the Calyptorhynchinae.[5]

The cockatiel is now biologically classified as a genuine member of Cacatuidae on account of sharing all of the cockatoo family's biological features, namely, the erectile crest, a gallbladder, powder down, suppressed cloudy-layer (which precludes the display of blue and green structural colours), and facial feathers covering the sides of the beak, all of which are rarely found outside the Cacatuidae family.

Sexual dimorphism[edit]

All wild cockatiels (also known as the normal grey cockatiel) chicks and juveniles are phenotypically female, and virtually indistinguishable from the time of hatching until their first moulting. They display horizontal yellow stripes or bars on the ventral surface of their tail feathers, yellow spots on the ventral surface of the primary flight feathers of their wings, a gray colored crest and face, and a dull orange patch on each of their cheeks.

Adult cockatiels are sexually dimorphic, though to a lesser degree than many other avian species. This is only evident after the first molting, typically occurring about six to nine months after hatching: the male loses the white or yellow barring and spots on the underside of his tail feathers and wings. The gray feathers on his cheeks and crest are replaced by bright yellow feathers, while the orange cheek patch becomes brighter and more distinct. The face and crest of the female will typically remain mostly gray, though also with an orange cheek patch. Additionally, the female commonly retains the horizontal barring on the underside of her tail feathers.

The color in cockatiels is derived from two pigments: Melanin (which provides the gray color in the feathers, eyes, beak, and feet), and lipochromes (which provide the yellow color on the face and tail and the orange color of the cheek patch). The gray color of the melanin overrides the yellow and orange of the lipochromes when both are present.

The melanin content decreases in the face of the males as they mature, allowing the yellow and orange lipochromes to be more visible, while an increase in melanin content in the tail causes the disappearance of the horizontal yellow tail bars.

In addition to these visible characteristics, the vocalization of adult males is typically louder and more complex than that of females.

Portrayal[edit]

1927 Brehms Tierleben painting

The cockatiel's distinctive erectile crest expresses the animal's emotional state. The crest is dramatically vertical when the cockatiel is startled or excited, gently oblique in its neutral or relaxed state, and flattened close to the head when the animal is angry or defensive. The crest is also held flat but protrudes outward in the back when the cockatiel is trying to appear alluring or flirtatious. In contrast to most cockatoos, the cockatiel has long tail feathers roughly making up half of its total length. At 30 cm to 33 cm (12 to 13 ins), the cockatiel is the smallest of the cockatoos. The latter ranging between 30 cm to 60 cm (12–24 in) in length.

The "Normal Grey" or "Wild-type" cockatiel's plumage is primarily grey with prominent white flashes on the outer edges of each wing. The face of the male is yellow or white, while the face of the female is primarily grey or light grey, and both sexes feature a round orange area on both ear areas, often referred to as "cheddar cheeks." This orange colouration is generally vibrant in adult males, and often quite muted in females. Visual sexing is often possible with this variant of the bird.

Distribution and habitat[edit]

Recording of a cockatiel.

Problems playing this file? See media help.

Cockatiels are native to Australia, where they are found largely in arid or semi-arid country, but always close to water. Largely nomadic, the species will move to where food and water is available.[2] They are typically seen in pairs or small flocks.[2] Sometimes, hundreds will flock around a single such body of water. To many farmers' dismay, they often eat cultivated crops. They are absent from the most fertile southwest and southeast corners of the country, the deepest Western Australian deserts, and Cape York Peninsula. They are the only Cockatoo species which can sometimes reproduce in the end of their first year.

Male and female, Pikedale, S. Queensland, Australia

Life span[edit]

The cockatiel's lifespan in captivity is generally given as 16–25 years,[6] though it is sometimes given as short as 10–15 years, and there are reports of cockatiels living as long as 32 years, the oldest confirmed specimen reported being 36 years old.[7] Diet and exercise are major determining factors in cockatiel lifespan.

Colour mutations[edit]

Fifteen different cockatiel colour mutations are currently established in aviculture, including Grey, Pied, Pearled, Cinnamon, Whitefaced, Lutino, Albino (aka. Whitefaced Lutino) and Yellowcheeked cockatiels. Mutations in captivity have emerged in various colors, some quite different from those observed in nature. In 1949 the species began to spread throughout the world, with the creation of "wild," and then "pied" mutation developed in California in the United States. There are many mutations of cockatiels with varied colors, they are: silvestre, harlequin, lutino, cinnamon, opaline (pearl), cara black, silver, fawn, albino (there is a pattern and not just albino genetic mutations), pastel, silver and recessive silver dominant.

Gallery[edit]

See also[edit]

Footnotes[edit]

  1. ^ BirdLife International (2012). "Nymphicus hollandicus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ a b c "Factsheets:Cockatiel". Australian Museum. Retrieved 2008-08-30. 
  3. ^ Adams M, Baverstock PR, Saunders DA, Schodde R, Smith GT, M; Baverstock, PR; Saunders, DA; Schodde, R; Smith, GT (1984). "Biochemical systematics of the Australian cockatoos (Psittaciformes: Cacatuinae)". Australian Journal of Zoology 32 (3): 363–77. doi:10.1071/ZO9840363. 
  4. ^ Brown, D.M. & Toft, C.A. (1999): Molecular systematics and biogeography of the cockatoos (Psittaciformes: Cacatuidae). Auk 116(1): 141-157.
  5. ^ Astuti, Dwi (2004): A phylogeny of Cockatoos (Aves: Psittaciformes) inferred from DNA sequences of the seventh intron of Nuclear ?-fibrinogen gene. Doctoral work, Graduate School of Environmental Earth Science, Hokkaido University, Japan.
  6. ^ cockatielcottage.net
  7. ^ Brouwer, K.; Jones, M.L., King, C.E. and Schifter, H. (2000). "Longevity records for Psittaciformes in captivity". International Zoo Yearbook 37 (1): 299–316. doi:10.1111/j.1748-1090.2000.tb00735.x. 

References[edit]

  • Astuti, Dwi (2004?): A phylogeny of cockatoos (Aves: Psittaciformes) inferred from DNA sequences of the seventh intron of nuclear β-fibrinogen gene. Doctoral work, Graduate School of Environmental Earth Science, Hokkaido University, Japan. PDF fulltext
  • Brown, D.M. & Toft, C.A. (1999): Molecular systematics and biogeography of the cockatoos (Psittaciformes: Cacatuidae). Auk 116(1): 141-157.
  • Flegg, Jim (2002): Photographic Field Guide: Birds of Australia. Reed New Holland, Sydney & London. ISBN 1-876334-78-9
  • Martin, Terry (2002). A Guide To Colour Mutations and Genetics in Parrots. ABK Publications. ISBN 0-9577024-6-9. 
  • Hayward, Jim (1992). The Manual of Colour Breeding. The Aviculturist Publications. ISBN 0-9519098-0-0. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!