Overview

Distribution

Habitat of the Carnarvon xeric shrublands, Australia

This ecoregion covers 34,900 square miles of critical/endangered deserts & xeric shrublands in Western Australia. The ecoregion's topography is chiefly low-lying, and the plantlife varies with the underlying geology, which is primarily comprised of recent alluvial, aeolian, and marine sediments over cretaceous strata. This ecoregion is extremely arid, claiming less than 250 millimetres of total precipitation per annum.

Covering the saline alluvial plains are chiefly low samphire and saltbush shrublands, with  snakewood scrublands upon the clay flats; Bowgada low woodland covers sandy ridges and plains, red sand dune fields are interspersed or overlain with tree to shrub steppe over hummock grasslands, and Acacia startii-A. bivenosa shrublands cover limestone outcrops at the north. Other tree species in the ecoregion include limestone wattle (Acacia sclerosperma) with an undergrowth of dead finish (Acacia tetragonophylla). The sheltered embayments and expansive tidal flats along the coastal zone support mangroves. Vertebrates of the ecoregion include birds such as the Thick-billed grasswren (Amytornis textilis) and the Australian endemic red-tailed black cockatoo (Calyptorhynchus banksii). This locale is  thought to be the sole possible habitat for a surviving population of the lesser stick-nest rat, which is otherwise potentially extinct.

Creative Commons Attribution 3.0 (CC BY 3.0)

© C.Michael Hogan; World Wildlife Fund; Encyclopedia of Earth

Supplier: C. Michael Hogan

Trusted

Article rating from 1 person

Average rating: 5.0 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 45.4 years (captivity) Observations: One specimen lived 45.4 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptorhynchus banksii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

ACCGCCCTAAGCCTACTTATTCGTGCAGAACTTGGTCAACCAGGGACTCTATTAGGAGATGACCAAATCTACAATGTAATCGTTACCGCCCATGCTTTTGTAATAATTTTCTTCATGGTAATACCAATTATGATTGGAGGATTTGGAAACTGATTAGTCCCTCTTATAATCGGTGCCCCTGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTACCCCCCTCCTTCCTTCTCCTACTAGCCTCATCCACAGTAGAGGCAGGGGCAGGCACAGGATGAACTGTCTACCCTCCCCTAGCTGGAAACCTAGCCCACGCTGGAGCCTCAGTAGACTTAGCCATCTTCTCCCTTCACCTGGCAGGTGTGTCCTCTATCCTAGGGGCAATTAACTTTATCACCACTGCTATCAACATAAAACCACCCACCCTATCACAATATCAGACTCCACTATTTGTCTGATCCGTCCTTATCACAGCTATCCTACTCCTACTATCTCTCCCAGTCCTAGCTGCTGGTATTACTATACTCCTTACAGATCGCAACCTAAACACTACATTCTTCGATCCAGCAGGAGGAGGAGACCCAATCCTATATCAACATCTCTTCTGATTCTTCGGACATCCAGAAGTATACATCCTTATTCTACCTGGATTCGGAATCATCTCACATGTAGTA
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calyptorhynchus banksii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 4
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)