Overview

Brief Summary

Biology

Baudin's black cockatoo generally lives in pairs or small groups in summer, often forming permanent pairs, but may congregate in large flocks during winter (6) (7). In summer, the birds mostly confine themselves to karri and marri forests, where they nest in hollows or the main trunk of old, large eucalypt trees (7) (9). A clutch of one to two eggs is laid by the female and incubated for about four weeks (7). Only one chick usually survives to fledge (2) (11), leaving the nest after around 90 days (7). In forested areas, Baudin's black cockatoos mainly feed on the seeds of marri and karri (7) (10). They are also fond of ripping timber apart to get at large, wood-boring grubs, and apple and pear orchards are frequently raided for the seeds of their fruit (7) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Baudin's black cockatoo is one of the 53 native parrot species seen in the Australian skies, their wailing cries penetrating their surroundings as they fly (5) (6). Also known as the long-billed black cockatoo, this bird is very similar in appearance to Carnaby's or the short-billed black cockatoo (Calyptorhynchus latirostris). Both have dusky-black feathers with off-white edges, creating a pattern of thin, scale-like crescents, as well as long black tails with a broad white band, and a white cheek patch (6). The only noticeable external difference between the two species is the longer and more pointed upper mandible of Baudin's black cockatoo, as implied by their respective common names (2) (6) (7). The fine point of Baudin's black cockatoo's bill enables it to prise out the seeds of the very hard wooden fruits of the marri (Corymbia calophylla), a preferred food of the species (7) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range

Extreme sw Australia (south of the Murchison River).
  • Clements, J. F., T. S. Schulenberg, M. J. Iliff, D. Roberson, T. A. Fredericks, B. L. Sullivan, and C. L. Wood. 2014. The eBird/Clements checklist of birds of the world: Version 6.9. Downloaded from http://www.birds.cornell.edu/clementschecklist/download/

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Confined to the south-west of Western Australia, mostly between Perth, Albany and Margaret River. Breeding takes place in the far south of the range, from Nornalup north to near Bridgetown, though occasionally further north to Lowden and Harvey (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Baudin's black cockatoo is found primarily in moist, temperate forest and woodland dominated by the eucalypts marri (Corymbia calophylla), karri (Eucalyptus diversicolor) and jarrah (E. marginata), but can also be found in apple and pear orchards and occasionally in wandoo E. wandoo woodland (9) (10). Whereas this species largely occupies coastal regions, its close relative, Carnaby's cockatoo, is usually found further north and inland in drier woodlands, but there is substantial overlap (8) and in summer and autumn the two species occur in the same woodlands and forest over a large part of the range of Baudin's black cockatoo (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 47 years (captivity) Observations: One specimen was still alive after 47 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptorhynchus baudinii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTAAACCGATGACTATTCTCAACCAACCACAAAGACATTGGTACCCTCTATCTCATTTTTGGTGCATGAGCTGGCATAATCGGTACTGCCCTAAGCCTGCTTATTCGTGCAGAACTCGGCCAACCTGGAACCTTACTAGGAGACGACCAAATCTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGCGGGTTTGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCCCCCTCTTTCCTTCTCCTGCTAGCTTCATCCACAGTAGAAGCCGGAGCAGGTACAGGATGAACCGTTTACCCTCCCCTGGCAGGAAACCTAGCCCACGCTGGAGCCTCAGTAGACTTAGCCATCTTCTCCCTCCACTTAGCAGGTGTATCCTCTATCCTAGGGGCAATCAATTTTATTACCACGGCCATTAACATAAAACCACCTGTCCTAACACAATACCAAACACCACTATTTGTCTGATCCGTCCTCATTACAGCCGTACTACTCCTCCTATCCCTCCCAGTCCTAGCTGCTGGTATTACCATGCTCCTTACAGACCGCAACTTAAACACCACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTATATCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTATATATCCTCATTCTACCCGGATTCGGAATCATCTCACATGTGGTAGCCTACTATGCAGGTAAAAAGGAACCTTTCGGCTACATAGGCATAGTATGAGCCATACTATCAATTGGATTCCTAGGATTTATCGTATGAGCACACCACATATTTACAGTAGGAATGGACGTAGACACCCGAGCATACTTTACATCCGCTACCATAATTATCGCCATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCTACCCTGCATGGAGGAGCCATCAAATGAGAACCCCCCATGCTATGGGCCCTAGGCTTTATTTTTCTATTCACTATCGGAGGCCTAACAGGAATCGTCCTGGCAAATTCCTCATTAGACATTGCCCTACATGACACATACTATGTAGTGGCACACTTCCACTACGTCCTTTCAATAGGAGCCGTATTTGCTATCTTAGCAGGACTCACCCACTGATTCCCACTATTCACTGGATTCACCTTACACCAGACATGAACCAAAGCACACTTCGGGGTCATATTCATTGGCGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGATTAGCAGGCATACCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACTCTGTCATCCATCGGCTCACTAATCTCAATAACAGCAGTAATCATATTAACATTTATCATCTGAGAAGCATTCGCCTCCAAACGGAAAATTCCACAACCAGAACTAACCTCCACCAATATTGAATGAATCCATGGTTGCCCTCCACCTTACCACACCTTCGAAGAACCCGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calyptorhynchus baudinii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Status

Classified as Endangered (EN) on the IUCN Red List (1) and listed on Appendix II of CITES (3). In Australia, it is listed as Vulnerable on the Environment Protection and Biodiversity Conservation Act (EPBC) 1999 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Up to a quarter of this species' habitat has been cleared for agriculture, causing considerable historical population declines. Logging of marri, first for woodchips and now for use in flooring and furniture, has dramatically reduced the availability of food and nesting trees. Additionally, many nest hollows have been found to be occupied by feral bees, which not only limit the bird's nest availability, but are also known to have caused the loss of chicks and killed a brooding female. Competition for nests from maned geese (Chenonetta jubatta) and Australian shelduck (Tadorna tadornoides) may also be a factor as duck numbers increase in the south-west (9) (12). Although the bird has been protected since 1996, shooting by orchard farmers still occurs (9) (10). 'Damage licenses' (shoot to scare only) can be issued allowing crop owners to “protect orchard crops” if it can be demonstrated that these cockatoos are causing damage (11) (13). Over past decades, farmers protecting their crops have probably culled thousands of these birds, and continue to do so at a reduced rate, with devastating consequences (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation

Baudin's black cockatoo is listed under Appendix II of CITES, limiting international trade in the species (3), and it is illegal to take these birds from the wild, with a penalty of up to a maximum of $10,000 for such an offence (12) (13). This cockatoo is given special protection under Western Australia's Wildlife Conservation Act 1950 (4) and has been protected under Australian law since 1996 (9). Forest management has now changed so that woodchipping practices ceased in 2003 (9) (10). However, the bird still clings to a precarious existence, and further conservation measures are desperately required to safeguard its future, including: making all shooting by commercial orchard farmers illegal; developing non-lethal methods of damage control; developing and implementing a feral bee control strategy; and protecting mature marri trees, relied upon so heavily as nest and food sources by this rare endemic bird (9). A Recovery Plan is also being prepared to help conserve this species (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baudin's black cockatoo

Baudin's black cockatoo (Calyptorhynchus baudinii), also known as Baudin's cockatoo or long-billed black cockatoo,[2] is a large black cockatoo found in Australia. The binomial commemorates the French explorer Nicolas Baudin.

Description[edit]

Baudin's black cockatoo is about 56 cm (22 in) long. It is mostly dark-grey with narrow vague light-grey scalloping, which is produced by narrow pale-grey margins at the tip of dark-grey feathers. It has a crest of short feathers on its head, and it has whitish patches of feathers that cover its ears. Its lateral tail feathers are white with black tips, and the central tail feathers are all black. The irises are dark brown and the legs are brown-grey. Its beak is longer and narrower than that of the closely related and similar Carnaby's black cockatoo.[3]

The adult male has a dark grey beak and pink eye-rings. The adult female has a bone coloured beak, grey eye-rings, and its ear patches are paler than that of the male. Juveniles have a bone coloured beak, grey eye-rings, and have less white in the tail feathers.[3]

One individual had reached an age of 47 years by 1996.[4]

Distribution and habitat[edit]

The Baudin's black cockatoo is one of two species of white-tailed black cockatoo endemic to south-western Australia which were only separated taxonomically in 1948. It is closely associated with moist, heavily forested areas dominated by Marri and is threatened by habitat destruction.

Sites identified by BirdLife International as being important for Baudin's black cockatoo conservation are Araluen-Wungong, Gidgegannup, Jalbarragup, Mundaring-Kalamunda, North Dandalup, the Stirling Range and The Lakes.[5]

References[edit]

  1. ^ BirdLife International (2012). "Calyptorhynchus baudinii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Christidis, Les and Walter E. Boles (2008) Systematics and Taxonomy of Australian Birds ISBN 978-0-643-06511-6
  3. ^ a b Forshaw (2006). plate 1.
  4. ^ Brouwer K, Jones M, King C, Schifter H (2000). "Longevity records for Psittaciformes in captivity". International Zoo Yearbook 37: 299–316. doi:10.1111/j.1748-1090.2000.tb00735.x. 
  5. ^ "Baudin’s Black-Cockatoo". Important Bird Areas. BirdLife International. 2012. Retrieved 2012-11-04. 

Cited texts[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!