Overview

Brief Summary

Biology

Baudin's black cockatoo generally lives in pairs or small groups in summer, often forming permanent pairs, but may congregate in large flocks during winter (6) (7). In summer, the birds mostly confine themselves to karri and marri forests, where they nest in hollows or the main trunk of old, large eucalypt trees (7) (9). A clutch of one to two eggs is laid by the female and incubated for about four weeks (7). Only one chick usually survives to fledge (2) (11), leaving the nest after around 90 days (7). In forested areas, Baudin's black cockatoos mainly feed on the seeds of marri and karri (7) (10). They are also fond of ripping timber apart to get at large, wood-boring grubs, and apple and pear orchards are frequently raided for the seeds of their fruit (7) (10).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Description

Baudin's black cockatoo is one of the 53 native parrot species seen in the Australian skies, their wailing cries penetrating their surroundings as they fly (5) (6). Also known as the long-billed black cockatoo, this bird is very similar in appearance to Carnaby's or the short-billed black cockatoo (Calyptorhynchus latirostris). Both have dusky-black feathers with off-white edges, creating a pattern of thin, scale-like crescents, as well as long black tails with a broad white band, and a white cheek patch (6). The only noticeable external difference between the two species is the longer and more pointed upper mandible of Baudin's black cockatoo, as implied by their respective common names (2) (6) (7). The fine point of Baudin's black cockatoo's bill enables it to prise out the seeds of the very hard wooden fruits of the marri (Corymbia calophylla), a preferred food of the species (7) (8).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Range Description

Calyptorhynchus baudinii occurs in the south-west of Western Australia, Australia, mostly between Perth, Albany and Margaret River. Breeding occurs in the far south of the range, from Nornalup north to near Bridgetown, though sometimes further north to Lowden and Harvey (Higgins 1999). The species has disappeared from c.25% of its range, and is thought to have declined in density over at least another 25%. Surveys during 1995-2004 suggest that the population is probably 10,000-15,000 individuals but that only c.10% of those birds make up the breeding population in any year (P. Mawson in litt. 2004). Many birds thought to be this species in the far south of its range are in fact Carnaby's Black-cockatoo C. latirostris, which occurs in the forest areas at a ratio of 5:1 with respect to C. baudinii (P. Mawson in litt. 2004). Populations are believed to be declining in response to ongoing threats. The rate of decline has been inferred from changes in habitat and competition to be >50% over 3 generations (58 years) (Garnett et al. 2011).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Extreme sw Australia (south of the Murchison River).

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Range

Confined to the south-west of Western Australia, mostly between Perth, Albany and Margaret River. Breeding takes place in the far south of the range, from Nornalup north to near Bridgetown, though occasionally further north to Lowden and Harvey (9).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Restricted to moist, heavily forested areas dominated by marri Eucalyptus calophylla, karri E. diversicolor and jarrah E. marginata. Its overall non-breeding range may be determined by distribution of marri, though it does occur in apple and pear orchards and occasionally in wandoo E. wandoo woodland (Higgins 1999). The species mainly feeds on the seeds and flowers of marri, as well as the seeds of Banksia, Hakea and Dryandra species, Erodium botrys and jarrah, and additionally takes insect larvae (DEC, Western Australia 2007a). It also feeds on apple and pear seeds (DEC, Western Australia 2007a) and is considered a pest owing to the damage it causes when extracting seeds from crops in commercial orchards (Chapman 2007, DEC, Western Australia 2007a). Damage to commercial fruit crops is thought to be higher during local or seasonal shortages of marri seeds, and could be related to destruction of this habitat (DEC, Western Australia 2007a). The species may live for 25 to 50 years in the wild (DEC, Western Australia 2007a). It breeds in large hollows of old karri, marri and jarrah (Higgins 1999, DEC, Western Australia 2007a) within heavily forested areas (Higgins 1999), although recent work suggests that there are very few nest sites, that breeding occurs very infrequently and that many nest hollows are being taken over by feral bees (P. Mawson in litt. 2004). Breeding data has indicated that pairs raise, on average, 0.6 chicks each year. In years of poor marri seed production, the population may fail to raise any young at all (DEC, Western Australia 2007a). The species has a strong association with very large (greater than 1.5m diameter) and old (230-300 years) marri trees, which may exacerbate declines (P. Mawson in litt. 2004).


Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Baudin's black cockatoo is found primarily in moist, temperate forest and woodland dominated by the eucalypts marri (Corymbia calophylla), karri (Eucalyptus diversicolor) and jarrah (E. marginata), but can also be found in apple and pear orchards and occasionally in wandoo E. wandoo woodland (9) (10). Whereas this species largely occupies coastal regions, its close relative, Carnaby's cockatoo, is usually found further north and inland in drier woodlands, but there is substantial overlap (8) and in summer and autumn the two species occur in the same woodlands and forest over a large part of the range of Baudin's black cockatoo (7).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 47 years (captivity) Observations: One specimen was still alive after 47 years in captivity (Brouwer et al. 2000).
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Calyptorhynchus baudinii

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCCTAAACCGATGACTATTCTCAACCAACCACAAAGACATTGGTACCCTCTATCTCATTTTTGGTGCATGAGCTGGCATAATCGGTACTGCCCTAAGCCTGCTTATTCGTGCAGAACTCGGCCAACCTGGAACCTTACTAGGAGACGACCAAATCTATAACGTAATCGTCACGGCCCATGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGCGGGTTTGGAAACTGACTAGTCCCCCTTATAATTGGCGCCCCCGACATAGCATTCCCACGCATAAACAACATAAGCTTCTGACTACTTCCCCCCTCTTTCCTTCTCCTGCTAGCTTCATCCACAGTAGAAGCCGGAGCAGGTACAGGATGAACCGTTTACCCTCCCCTGGCAGGAAACCTAGCCCACGCTGGAGCCTCAGTAGACTTAGCCATCTTCTCCCTCCACTTAGCAGGTGTATCCTCTATCCTAGGGGCAATCAATTTTATTACCACGGCCATTAACATAAAACCACCTGTCCTAACACAATACCAAACACCACTATTTGTCTGATCCGTCCTCATTACAGCCGTACTACTCCTCCTATCCCTCCCAGTCCTAGCTGCTGGTATTACCATGCTCCTTACAGACCGCAACTTAAACACCACATTCTTTGACCCAGCAGGAGGAGGAGACCCAATCCTATATCAACATCTCTTCTGATTCTTCGGACACCCAGAAGTATATATCCTCATTCTACCCGGATTCGGAATCATCTCACATGTGGTAGCCTACTATGCAGGTAAAAAGGAACCTTTCGGCTACATAGGCATAGTATGAGCCATACTATCAATTGGATTCCTAGGATTTATCGTATGAGCACACCACATATTTACAGTAGGAATGGACGTAGACACCCGAGCATACTTTACATCCGCTACCATAATTATCGCCATCCCAACCGGAATCAAAGTATTCAGCTGACTAGCTACCCTGCATGGAGGAGCCATCAAATGAGAACCCCCCATGCTATGGGCCCTAGGCTTTATTTTTCTATTCACTATCGGAGGCCTAACAGGAATCGTCCTGGCAAATTCCTCATTAGACATTGCCCTACATGACACATACTATGTAGTGGCACACTTCCACTACGTCCTTTCAATAGGAGCCGTATTTGCTATCTTAGCAGGACTCACCCACTGATTCCCACTATTCACTGGATTCACCTTACACCAGACATGAACCAAAGCACACTTCGGGGTCATATTCATTGGCGTAAACCTAACCTTCTTCCCCCAACACTTCCTAGGATTAGCAGGCATACCACGACGATACTCAGACTACCCAGACGCCTACACACTATGAAACACTCTGTCATCCATCGGCTCACTAATCTCAATAACAGCAGTAATCATATTAACATTTATCATCTGAGAAGCATTCGCCTCCAAACGGAAAATTCCACAACCAGAACTAACCTCCACCAATATTGAATGAATCCATGGTTGCCCTCCACCTTACCACACCTTCGAAGAACCCGCCTTCGTCCAAGTACAAGAAAGG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Calyptorhynchus baudinii

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
EN
Endangered

Red List Criteria
C2a(ii)

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Taylor, J. & Butchart, S.

Contributor/s
Chapman, T., Garnett, S. & Mawson, P.

Justification
Despite this species having a moderately small population, only about 10% of individuals make up the breeding population, and numbers are in decline. The species is therefore listed as Endangered.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Status

Classified as Endangered (EN) on the IUCN Red List (1) and listed on Appendix II of CITES (3). In Australia, it is listed as Vulnerable on the Environment Protection and Biodiversity Conservation Act (EPBC) 1999 (4).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The 1995-2004 surveys of the species suggest the total population is probably still 10,000-15,000 individuals but that only c.10% of those birds make up the breeding population, giving an estimate of 1,000-1,500 mature individuals (P. Mawson in litt. 2004).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
Up to a quarter of the species's habitat has been cleared for agriculture, with 8,933,294 m3 of marri harvested during 1976-1998 (P. Mawson in litt. 2004). Nest hollow shortage is considered the principal threat, as suitable hollows are considered scarce, only forming in trees at least 130 to 220 years of age, many of which have been preferentially felled (Chapman 2007). The past and present impacts of logging for marri, initially for woodchips and now for furniture grade sawlogs, are reducing the availability of food and nesting trees. The impact of logging and woodchipping has not been quantified. Although logging of old growth forest in the south-west has now stopped, habitat loss is still likely to be causing population declines, and a sawlog industry based on marri has now been proposed with a projected minimum bole log harvest of 286,000 m3 per annum (P. Mawson in litt. 2004). Feral European honey bees Apis mellifera have been found to occupy many potential nest sites, and are known to have caused the loss of chicks and killed a brooding female (P. Mawson in litt. 2004). Although the species has been fully protected since 1996, illegal shooting by orchardists still occurs (P. Mawson in litt. 2004, Chapman 2007). It is not known whether losses from shooting exceed productivity (P. Mawson in litt. 2004). Continued loss of forest to mining in some areas is also an issue, since revegetation will have no impact on conservation outcomes within the lifespan of this species (P. Mawson in litt. 2004). Competition for nests from Wood Ducks Chenonetta jubatta is thought to be increasing as duck numbers increase in the south-west (P. Mawson in litt. 2004).

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Up to a quarter of this species' habitat has been cleared for agriculture, causing considerable historical population declines. Logging of marri, first for woodchips and now for use in flooring and furniture, has dramatically reduced the availability of food and nesting trees. Additionally, many nest hollows have been found to be occupied by feral bees, which not only limit the bird's nest availability, but are also known to have caused the loss of chicks and killed a brooding female. Competition for nests from maned geese (Chenonetta jubatta) and Australian shelduck (Tadorna tadornoides) may also be a factor as duck numbers increase in the south-west (9) (12). Although the bird has been protected since 1996, shooting by orchard farmers still occurs (9) (10). 'Damage licenses' (shoot to scare only) can be issued allowing crop owners to “protect orchard crops” if it can be demonstrated that these cockatoos are causing damage (11) (13). Over past decades, farmers protecting their crops have probably culled thousands of these birds, and continue to do so at a reduced rate, with devastating consequences (13).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions
Conservation Actions Underway
CITES Appendix II. Protected under Australian law since 1996. Forest management has now changed so that woodchipping apparently ceased in 2003. Research into the breeding biology of the species is ongoing but is hampered by difficulties in finding nests (P. Mawson in litt. 2004). An information sheet was produced by the Government of Western Australia in 2007, outlining the status of the species and promoting non-lethal control methods by orchardists, e.g. exclusion netting (DEC, Western Australia 2007a).

Conservation Actions Proposed
Prevent illegal shooting in and around commercial orchard areas and more vigorously enforce anti-shooting legislation. Assist orchardists in developing a non-lethal damage mitigation strategy. Continue to raise awareness of the species's status amongst orchardists and promote non-lethal control methods (Chapman 2007). Develop and implement a feral bee control strategy. Retain mature and over-mature marri trees as nest and food sources as part of forest management prescriptions (P. Mawson in litt. 2004). Develop a repeatable population monitoring technique. Initiate monitoring in different parts of range.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Baudin's black cockatoo is listed under Appendix II of CITES, limiting international trade in the species (3), and it is illegal to take these birds from the wild, with a penalty of up to a maximum of $10,000 for such an offence (12) (13). This cockatoo is given special protection under Western Australia's Wildlife Conservation Act 1950 (4) and has been protected under Australian law since 1996 (9). Forest management has now changed so that woodchipping practices ceased in 2003 (9) (10). However, the bird still clings to a precarious existence, and further conservation measures are desperately required to safeguard its future, including: making all shooting by commercial orchard farmers illegal; developing non-lethal methods of damage control; developing and implementing a feral bee control strategy; and protecting mature marri trees, relied upon so heavily as nest and food sources by this rare endemic bird (9). A Recovery Plan is also being prepared to help conserve this species (12).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Wildscreen

Source: ARKive

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Baudin's black cockatoo

Baudin's black cockatoo (Calyptorhynchus baudinii), also known as Baudin's cockatoo or long-billed black cockatoo,[2] is a large black cockatoo found in Australia. The binomial commemorates the French explorer Nicolas Baudin.

Description[edit]

Baudin's black cockatoo is about 56 cm (22 in) long. It is mostly dark-grey with narrow vague light-grey scalloping, which is produced by narrow pale-grey margins at the tip of dark-grey feathers. It has a crest of short feathers on its head, and it has whitish patches of feathers that cover its ears. Its lateral tail feathers are white with black tips, and the central tail feathers are all black. The irises are dark brown and the legs are brown-grey. Its beak is longer and narrower than that of the closely related and similar Carnaby's black cockatoo.[3]

The adult male has a dark grey beak and pink eye-rings. The adult female has a bone coloured beak, grey eye-rings, and its ear patches are paler than that of the male. Juveniles have a bone coloured beak, grey eye-rings, and have less white in the tail feathers.[3]

One individual had reached an age of 47 years by 1996.[4]

Distribution and habitat[edit]

The Baudin's black cockatoo is one of two species of white-tailed black cockatoo endemic to south-western Australia which were only separated taxonomically in 1948. It is closely associated with moist, heavily forested areas dominated by Marri and is threatened by habitat destruction.

Sites identified by BirdLife International as being important for Baudin's black cockatoo conservation are Araluen-Wungong, Gidgegannup, Jalbarragup, Mundaring-Kalamunda, North Dandalup, the Stirling Range and The Lakes.[5]

References[edit]

  1. ^ BirdLife International (2012). "Calyptorhynchus baudinii". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Christidis, Les and Walter E. Boles (2008) Systematics and Taxonomy of Australian Birds ISBN 978-0-643-06511-6
  3. ^ a b Forshaw (2006). plate 1.
  4. ^ Brouwer K, Jones M, King C, Schifter H (2000). "Longevity records for Psittaciformes in captivity". International Zoo Yearbook 37: 299–316. doi:10.1111/j.1748-1090.2000.tb00735.x. 
  5. ^ "Baudin’s Black-Cockatoo". Important Bird Areas. BirdLife International. 2012. Retrieved 2012-11-04. 

Cited texts[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!