Overview

Distribution

Toco toucans (Ramphastos toco) thrive over a wide range of habitats and locations throughout much of the Neotropical region. They are native to the countries of Argentina, Peru, French Guiana, Bolivia, Paraguay, Suriname, and Brazil. Studies have shown a correlation between the wide range of R. toco and the availability of fleshy fruits, which make up the majority of the toucan's diet.

Biogeographic Regions: neotropical (Native )

  • BirdLife International, 2009. "IUCN red list of threatened species" (On-line). Accessed February 11, 2010 at http://www.iucnredlist.org/apps/redlist/details/141926/0.
  • Ragusa-Netto, J. 2006. Abundance and frugivory of the toco toucan (Ramphastos toco) in a gallery forset in Brazil's Southern Pantanal. Brazilian Journal of Biology, 66: 133-142.
  • Ragusa-Netto, J. 2008. Toco toucan feeding ecology and local abundance in a habitat mosaic in the Brazilian cerrado. Ornithologia Neotropical, 19: 345-359.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Toco toucans are recognized as the largest species in the toucan family and flaunt the biggest beak in regard to body size of all birds. This large yellow-orange colored beak with a distinct black marking at the tip of the bill is the most noticeable feature of R. toco. It accounts for one-twentieth of the total mass of the toucan, while also contributing to one-third of the bird's total length. Toco toucans weigh between 592 and 760 g, and average 61 cm in length. This species has what appears to be a blue iris, but is in fact a thin layer of skin that surrounds the eye. The blue circle is encompassed by an additional ring of orange skin that adds to the colorful physical appearance of toco toucans. Its basal metabolic rate is estimated at 8.72 cubed cm of oxygen per hour. Sexual dimorphism is present in this species of toucan. Measurements and observations reveal physical differences between males and females. Adult male toco toucans are typically larger than adult females. Juveniles are easily differentiated from the adults due to the young's duller colors and stubbier bill.

Range mass: 592 to 760 g.

Average length: 61 cm.

Average basal metabolic rate: 8.72 cm3.O2/g/hr.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: male larger

  • Castro, M., S. Recco-Pimentel, G. Rocha. 2003. Sexual dimorphism in Ramphastos toco and Ramphostos dicolorus (Piciformes, Aves). Revista de Biologia Tropical, 51: 241-245.
  • McNab, B. 2009. Ecological factors affect the level and scaling of avian BMR. Comparative Biochemisty and Physiology, 152: 22-45.
  • Seki, Y., M. Schneider, M. Meyers. 2005. Structure and mechanical behavior of a toucan beak. Acta Materialia, 53: 5281-5296.
  • Tattersall, G., D. Andrade, A. Abe. 2009. Heat exchange from the toucan bill reveals a controllable cascular thermal radiator. Science, 325: 468-470.
  • Zoological Society of San Diego, 2010. "Toco Toucan" (On-line). Accessed February 12, 2010 at http://www.sandiegozoo.org/animalbytes/t-toucan.html.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Toco toucans are most commonly found in dry semi-open areas, which include regions such as woodland, savanna, plantations, and other regions that consist of scattered trees. In Brazil, toco toucans have been found in abundance in the "cerrado." Brazil's cerrado consists of savanna, semidecidious, and gallery forests surrounding river corridors. They are canopy frugivores that rely heavily on the availability of seasonal fruiting plants. Toco toucans therefore move from one habitat and region to the next in order to satisfy their dietary needs. This species is typically found at lowland elevations. However they have been sighted in elevations up to 1750 m around the Andes mountain range of South America.

Range elevation: 1750 (high) m.

Habitat Regions: tropical ; terrestrial

Terrestrial Biomes: savanna or grassland ; forest ; scrub forest

Other Habitat Features: riparian

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Toco toucans are canopy frugivores whose diet is composed mainly of fruits, but they are considered to be an opportunistic feeder. They also occasionally feed on various types of insects and eggs of other birds, including those of endangered hyacinth macaws (Anodorhynchus hyacinthinus). Their broad geographical range of habitats is due in part to their foraging behavior and their diet of briefly-available fruits. The food sources include the fruits from trees such as genipapo (Genipa americana), agarrapolo (Ficus luschnathiana), ambay pumpwood (Cecropia pachystachya).

The large bills of toco toucans are the main foraging tool that allows the birds to reach into tree holes and to grasp fruits from surrounding branches. Toco toucans are unique in that they does not use their tongue in the process of swallowing food. Instead, they place a piece of fruit between the very end of their beak and lean their head back at an approximately 180 degree angle. This causes the food item to project directly into the pharynx.

Animal Foods: amphibians; reptiles; eggs; insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: herbivore (Frugivore )

  • Baussart, S. 2007. Feeding mechanism in fruit-eating bird toucan, Ramphastos toco. Comparative Biochemisty and Physiology, 146: S107.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Even though toco toucans prey on the eggs of endangered hyacinth macaws (Anodorhynchus hyacinthinus), these macaws are in fact indirectly dependent on the toucans. Since hyacinth macaws almost always nest in the hollows of the manduvi tree and the manduvi tree depends upon the seed dispersal services provided by toco toucans, hyacinth macaws are indirectly dependent on this species of toucan.

Ecosystem Impact: disperses seeds

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Although the colorful characteristics of toco toucans provide adequate camouflage in the forest canopy, common predators include jaguars (Panthera onca), snakes (order Serpentes), coatis (Nasua and Nasuella species), and eagles (Accipitridae).

Known Predators:

Anti-predator Adaptations: cryptic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Toco toucans are very loud communicators with various means of sound production. Their repertoire consists of deep, course croaking that is repeated on a consistent basis. A rattling call is also a common form of conversation in this species. Besides vocal communication, they use bill-clacking as a form of auditory communication. Like all birds, toco toucans perceive their environment through visual, auditory, tactile, and chemical stimuli.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

A lifespan of 20 years is typically seen in wild toco toucans with a maximum recorded lifespan of 26 years. In captivity, this species of toucan often has a shorter lifespan of approximately 18 years. Toco toucans that have been raised in captivity often experience iron-storage disease, which is sometimes referred to as hemochromatosis. This disease can lead to an uncomfortable life of the toucan involving emaciation, dyspnea, and feather picking and may eventually lead to the death of the bird. Since the diet of toco toucans is primarily fruits, which involves a low intake of iron, they have seemed to develop very iron-absorbent organs. When a toxic amount of iron builds-up within the liver of the bird due to the high-iron diet that many of these captive toucans are fed, the iron-storage disease occurs.

Average lifespan

Status: wild:
26 years.

Average lifespan

Status: wild:
20 years.

Average lifespan

Status: captivity:
18 years.

  • Drews, A., S. Redrobe, J. Patterson-Kane. 2004. Successful reduction of hepatocellular hemosiderin content by dietary modification in toco toucans (Ramphastos toco) with iron-storage disease. Journal of Avian Medicine and Surgery, 18: 101-105.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

The large colorful bills of toco toucans are often thought to be used in mate choice, but there are no specific studies that lead to this conclusion. However, it is known that this species uses its bill to gather fruit that is used in the bird's mating ritual. This courtship ritual consists of either the male or female initiating a fruit toss with its potential mate. After this ritual has been carried out, the male mates with the female.

Mating System: monogamous

The breeding season for toco toucans occurs in the spring. Tree cavities are the typical nesting site where a single clutch of 2 to 4 eggs are laid by the female. Toco toucans breed yearly and have altricial young. The hatchlings are bare-skinned, close-eyed, and helpless until approximately 6 to 8 weeks later. At this time, the young begin to develop their characteristic beak and will soon fledge. Toco toucans become sexually mature in 3 to 4 years.

Breeding interval: Toco toucans breed once yearly.

Breeding season: The breeding season occurs in the spring.

Range eggs per season: 2 to 4.

Range time to hatching: 15 to 18 days.

Range fledging age: 6 to 8 weeks.

Range age at sexual or reproductive maturity (female): 3 to 4 years.

Range age at sexual or reproductive maturity (male): 3 to 4 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Both parents take turns incubating the eggs in the small cavity of a tree where the nest is situated. Nests of this species were found to be lined with regurgitated manduvi seeds from the manduvi tree (Sterculia apetala), suggesting that parents may provision nestlings with this fruit. The young remain in the nest for about 6 to 8 weeks.

Parental Investment: altricial ; male parental care ; female parental care ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Provisioning: Male, Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Bill used as heat exchanger for thermoregulation: toco toucan
 

Bill of toco toucan acts as a heat exchanger to regulate body temperature by adjusting blood flow

   
  "The toco toucan (Ramphastos toco), the largest member of the toucan family, possesses the largest beak relative to body size of all birds. This exaggerated feature has received various interpretations, from serving as a sexual ornament to being a refined adaptation for feeding. However, it is also a significant surface area for heat exchange. The toco toucan has the remarkable capacity to regulate heat distribution by modifying blood flow, using the bill as a transient thermal radiator. Results indicate that the toucan's bill is, relative to its size, one of the largest thermal windows in the animal kingdom, rivaling elephants’ ears in its ability to radiate body heat." (Tattersall et al. 2009:468)


Watch Video
Sleep-state transitions witnessed as changes in bill temperature.  This is a thermal imaging video showing transient changes in bill temperature  that occur during sleep while the bill is tucked  between the wings. Time-lapsed data obtained at 10-s intervals. Total  frames  = 724, total length = 2.7 hours.    Filmed by the Tattersall Laboratory.
  Learn more about this functional adaptation.
  • Tattersall, GJ; Andrade, DV; Abe, AS. 2009. Heat exchange from the toucan bill reveals a controllable vascular thermal radiator. Science. 325(5939): 468-470.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Functional adaptation

Beak design absorbs high-energy impacts: toco toucan
 

Toucan beaks are built lightweight and strong thanks to a rigid foamy inside and layers of fibrous keratin tile outside.

   
  "The Toucan's beak measures one-third the length of the bird but accounts for a mere one twentieth of its weight (Acta Mater. 2005, 53, 5281). Using electron microscopy, the researchers found that the exterior of the beak is made up of overlapping tiles of keratin, the sulfur-containing fibrous protein that makes up hair, fingernails, and horn. The interior of the beak is constructed of a rigid foam made of a network of calcium-rich bony fibers connected by membranes. The membranes are similar in composition to keratin. Meyers was surprised by the beak's ability to absorb high-energy impacts." (no author 2005:26)

"The toucan beak, which comprises one third of the length of the bird and yet only about 1/20th of its mass, has outstanding stiffness. The structure of a Toco toucan (Ramphastos toco) beak was found to be a sandwich composite with an exterior of keratin and a fibrous network of closed cells made of calcium-rich proteins. The keratin layer is comprised of superposed hexagonal scales (50 µm diameter and 1 µm thickness) glued together. Its tensile strength is about 50 MPa and Young’s modulus is 1.4 GPa. Micro and nanoindentation hardness measurements corroborate these values. The keratin shell exhibits a strain-rate sensitivity with a transition from slippage of the scales due to release of the organic glue, at a low strain rate (5 · 10-5/s) to fracture of the scales at a higher strain rate (1.5 · 10-3/s). The closed-cell foam is comprised of fibers having a Young’s modulus twice as high as the keratin shells due to their higher calcium content. The compressive response of the foam was modeled by the Gibson–Ashby constitutive equations for open and closed-cell foam. There is a synergistic effect between foam and shell evidenced by experiments and analysis establishing the separate responses of shell, foam, and foam + shell. The stability analysis developed by Karam and Gibson, assuming an idealized circular cross section, was applied to the beak. It shows that the foam stabilizes the deformation of the beak by providing an elastic foundation which increases its Brazier and buckling load under flexure loading." (Seki et al. 2005:5281)

  Learn more about this functional adaptation.
  • 2005. Science Concentrates: Secrets of toucan beak revealed. Chem. Eng. News. 83(50):
  • Seki Y; Schneider MS; Meyers MA. 2005. Structure and mechanical behavior of a toucan beak. Acta Materialia. 53(20): 5281-5296.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos toco

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 2 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCACCAATCGATGACTATTCTCCACCAACCACAAAGACATTGGCACCCTCTACCTCATTTTCGGCGCATGAGCAGGCATGATCGGCACAGCCTTAAGTCTCCTCATCCGAGCAGAACTTGGTCAACCAGGGACCCTCCTGGGCGACGACCAAATCTATAACGTAATCGTTACCGCCCACGCATTCGTAATAATCTTCTTCATGGTCATACCCATCATAATCGGAGGCTTTGGTAACTGACTTGTTCCCTTGATAATTGGAGCCCCAGACATGGCCTTCCCGCGCATGAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTACTCCTTGCATCCTCCACAGTCGAAGCTGGAGCCGGAACCGGATGAACTGTCTACCCCCCTCTAGCCGGTAACCTAGCCCACGCTGGGGCCTCAGTTGACCTAGCCATCTTCTCCTTACACCTAGCAGGGGTTTCATCCATCCTCGGTGCAATCAACTTCATCACTACCGCTATCAACATAAAACCACCAGCCATCTCACAATACCAAACACCCCTATTTGTCTGATCCGTACTCATCACTGCCGTCCTACTCCTACTATCCCTCCCCGTCCTTGCCGCAGGCATCACCATACTCCTCACCGACCGCAATCTAAACACCACATTCTTCGACCCAGCTGGAGGAGGCGACCCAGTCCTATACCAACACCTCTTCTGATTCTTCGGCCACCCCGAAGTCTACATCCTCATTCTCCCAGGATTTGGCATCATCTCCCACGTAGTAAC
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos toco

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

Toco toucans are considered by the IUCN Red List of Threatened Species to be of "least concern." This is due to the broad range and fairly common status of this species in its designated habitats and biogeographic range. They are listed under appendix II of CITES which regulates the trade of this species.

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse effects of toco toucans on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Because of the natural attraction to the colorful and odd bills of toco toucans, tour guides in many South American countries provide trips to see them in their natural habitat. Also, many zoos attempt to preserve the natural beauty of this bird in a safe and people-friendly environment. Toco toucans are also found in the pet trade.

Positive Impacts: pet trade ; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!