Overview

Distribution

Range Description

Ramphastos tucanus has a wide from eastern Venezuela through Guyana, Suriname and French Guiana, east of the Rio Negro in northeast Brazil and also south of the Amazon in northern Par and Maranho states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Lowland tropical forest, especially old riverbeds, late stage successional forest, and mature forest near water. Also forages in secondary forest, edges, clearings, forest patches, pasture trees, plantations, gardens, mangroves etc; to 1,440 m in Guyana (del Hoyo et al. 2002). Feeds on a diverse variety of fruits, also flowers and nectar, beetles, caterpillars, cicadas, termites, lizards, bird eggs and birds, foraging in the canopy singly, in pairs or small groups (del Hoyo et al. 2002). Lays two-three eggs in a deep natural cavity in a tree at 3-20 m height. The home range of a group is large, and birds may move large distances in search of fruit (del Hoyo et al. 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos tucanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACGTTATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTAAGTCTCCTCATCCGAGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTCACCGCCCACGCGTTCGTAATAATCTTCTTCATGGTTATACCCATCATAATCGGGGGCTTTGGCAACTGGCTCGTCCCTCTAATAATCGGAGCCCCAGACATAGCTTTCCCACGCATAAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTCCTCGCTTCATCCACAGTCGAAGCTGGGGCCGGGACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTTGACCTAGCCATCTTCTCCCTACATTTAGCGGGAGTTTCATCCATCCTAGGTGCAATCAACTTCATCACCACCGCCATCAACATAAAACCACCAGCCATCTCACAATACCAAACACCACTGTTTGTCTGATCCGTACTCATCACTGCCGTCCTACTTCTTTTATCCCTCCCCGTCCTCGCCGCAGGCATCACCATACTCCTCACCGATCGCAATCTAAACACCACATTCTTTGACCCAGCTGGGGGAGGTGACCCTGTCCTATATCAACACCTCTTCTGATTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos tucanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4cd

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
Based on a model of deforestation in the Amazon basin, and the species's susceptibility to hunting, it is suspected that its population is declining rapidly over three generations, and it has therefore been classified as Vulnerable.

History
  • Not Recognized (NR)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The primary threat to this species is accelerating deforestation in the Amazon basin as land is cleared for cattle ranching and soy production, facilitated by expansion of the road network (Soares-Filho et al. 2006, Bird et al. 2011). It is also declining as a result of hunting pressure (del Hoyo et al. 2002). Proposed changes to the Brazilian Forest Code reduce the percentage of land a private landowner is legally required to maintain as forest (including, critically, a reduction in the width of forest buffers alongside perennial steams) and include an amnesty for landowners who deforested before July 2008 (who would subsequently be absolved of the need to reforest illegally cleared land) (Bird et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Conservation and research actions underway
No targeted actions are known.

Conservation and research actions proposed

Expand the protected area network to effectively protect IBAs. Effectively resource and manage existing and new protected areas, utilising emerging opportunities to finance protected area management with the joint aims of reducing carbon emissions and maximizing biodiversity conservation. Conservation on private lands, through expanding market pressures for sound land management and preventing forest clearance on lands unsuitable for agriculture, is also essential (Soares-Filho et al. 2006). Campaign against proposed changes to the Brazilian Forest Code that would lead to a decrease in the width of the areas of riverine forest protected as Permanent Preservation Areas (APPs), which function as vital corridors in fragmented landscapes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5