Overview

Distribution

Range Description

Ramphastos tucanus has a wide from eastern Venezuela through Guyana, Suriname and French Guiana, east of the Rio Negro in northeast Brazil and also south of the Amazon in northern Pará and Maranhão states.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Habitat and Ecology
Lowland tropical forest, especially old riverbeds, late stage successional forest, and mature forest near water. Also forages in secondary forest, edges, clearings, forest patches, pasture trees, plantations, gardens, mangroves etc; to 1,440 m in Guyana (del Hoyo et al. 2002). Feeds on a diverse variety of fruits, also flowers and nectar, beetles, caterpillars, cicadas, termites, lizards, bird eggs and birds, foraging in the canopy singly, in pairs or small groups (del Hoyo et al. 2002). Lays two-three eggs in a deep natural cavity in a tree at 3-20 m height. The home range of a group is large, and birds may move large distances in search of fruit (del Hoyo et al. 2002).

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos tucanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACGTTATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTAAGTCTCCTCATCCGAGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTCACCGCCCACGCGTTCGTAATAATCTTCTTCATGGTTATACCCATCATAATCGGGGGCTTTGGCAACTGGCTCGTCCCTCTAATAATCGGAGCCCCAGACATAGCTTTCCCACGCATAAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTCCTCGCTTCATCCACAGTCGAAGCTGGGGCCGGGACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTTGACCTAGCCATCTTCTCCCTACATTTAGCGGGAGTTTCATCCATCCTAGGTGCAATCAACTTCATCACCACCGCCATCAACATAAAACCACCAGCCATCTCACAATACCAAACACCACTGTTTGTCTGATCCGTACTCATCACTGCCGTCCTACTTCTTTTATCCCTCCCCGTCCTCGCCGCAGGCATCACCATACTCCTCACCGATCGCAATCTAAACACCACATTCTTTGACCCAGCTGGGGGAGGTGACCCTGTCCTATATCAACACCTCTTCTGATTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos tucanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
VU
Vulnerable

Red List Criteria
A4cd

Version
3.1

Year Assessed
2014

Assessor/s
BirdLife International

Reviewer/s
Butchart, S.

Contributor/s

Justification
Based on a model of deforestation in the Amazon basin, and the species's susceptibility to hunting, it is suspected that its population is declining rapidly over three generations, and it has therefore been classified as Vulnerable.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. 1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Major Threats
The primary threat to this species is accelerating deforestation in the Amazon basin as land is cleared for cattle ranching and soy production, facilitated by expansion of the road network (Soares-Filho et al. 2006, Bird et al. 2011). It is also declining as a result of hunting pressure (del Hoyo et al. 2002). Proposed changes to the Brazilian Forest Code reduce the percentage of land a private landowner is legally required to maintain as forest (including, critically, a reduction in the width of forest buffers alongside perennial steams) and include an amnesty for landowners who deforested before July 2008 (who would subsequently be absolved of the need to reforest illegally cleared land) (Bird et al. 2011).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Conservation Actions

Conservation Actions

Conservation and research actions underway
No targeted actions are known.

Conservation and research actions proposed

Expand the protected area network to effectively protect IBAs. Effectively resource and manage existing and new protected areas, utilising emerging opportunities to finance protected area management with the joint aims of reducing carbon emissions and maximizing biodiversity conservation. Conservation on private lands, through expanding market pressures for sound land management and preventing forest clearance on lands unsuitable for agriculture, is also essential (Soares-Filho et al. 2006). Campaign against proposed changes to the Brazilian Forest Code that would lead to a decrease in the width of the areas of riverine forest protected as Permanent Preservation Areas (APPs), which function as vital corridors in fragmented landscapes.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

White-throated toucan

At first this may resemble a Cuvier's toucan, R. t. cuvieri, but a closer look reveals a brownish patch on the upper part of the mandible, identifying it as a tucanus-cuvieri intergrade.
Red-billed toucan
Ramphastos t. tucanus

The white-throated toucan (Ramphastos tucanus) is a near-passerine bird found throughout the Amazon in south-eastern Colombia, eastern Ecuador, eastern Peru, northern Bolivia, southern and eastern Venezuela, northern and western Brazil, including the Amazon Basin's adjacent Tocantins-Araguaia River drainage, and the Guianas. It prefers tropical humid forest, but also occurs in woodland and locally in riverine forest within the Cerrado.

It was formerly considered to be two species, with the southern and western nominate subspecies, R. t. tucanus, named the red-billed toucan, and the northern and eastern subspecies, R. t. cuvieri, Cuvier's toucan (when considered a species; R. cuvieri, Wagler, 1827). However, the two subspecies, which differ principally in the bill colour, interbreed freely wherever they meet and therefore merit only subspecies status. The subspecies R. t. inca from Bolivia is of questionable validity and may represent a stable hybrid population between tucanus and culminatus.

Description[edit]

Like other toucans, the white-throated toucan is brightly marked and has a huge bill. It has a total length of 50–61 cm (20–24 in).[2] Body weight is somewhat variable, ranging in adult birds from 425 to 830 g (0.937 to 1.830 lb). The male averages slightly larger, at a mass of 642 g (1.415 lb), while the female averages 580 g (1.28 lb). Among standard measurements, the wing chord is 20.4 to 26.5 cm (8.0 to 10.4 in), the bill is 12.2 to 22 cm (4.8 to 8.7 in), the tail is 13.3 to 16.8 cm (5.2 to 6.6 in), and the tarsus is 4.5 to 5.6 cm (1.8 to 2.2 in).[3] The only species of toucan that surpasses the white-throated in size is the toco toucan.

It has black plumage with a white throat and breast bordered below with a narrow red line. The rump is bright yellow and the crissum is red. The bare skin around the eye is blue. The bill has a yellow tip, upper ridge and base of the upper mandible, and the base of the lower mandible is blue. The rest of the bill is mainly black in R. t. cuvieri and mainly reddish-brown in R. t. tucanus, with intergrades showing a mixed coloration. Males are larger and longer-billed than females, but otherwise the sexes are alike.

Juveniles are noticeably shorter-billed, more sooty-black, and have duller plumage.

The white-throated toucan of the race cuvieri is virtually identical to the related channel-billed toucan of the race culminatus, but the latter is smaller and has a proportionally shorter bill with a more strongly keeled culmen. The call is often the best distinction between the species. White-throated has a yelping eeoo, hue hue, whereas channel-billed has a croaking song.

Behaviour[edit]

Small flocks or more commonly pairs of birds move through the forest with a heavy, rather weak, undulating flight, rarely flying more than 100 m (330 ft) at a time. This species is primarily an arboreal fruit-eater, but will also take insects, lizards, eggs, and small birds.

Breeding[edit]

The 2–4 white eggs are laid in an unlined cavity high in a decayed section of a living tree, or in an old woodpecker nest in a dead tree.

Both sexes incubate the eggs for at 14–15 days, and the toucan chicks remain in the nest after hatching. They are blind and naked at birth, with short bills, and have specialised pads on their heels to protect them from the rough floor of the nest. They are fed by both parents, and fledge after about 6 weeks. The parents continue feeding the juveniles for several weeks after they have left the nest.

References[edit]

  • Steven L. Hilty (2003). Birds of Venezuela. Christopher Helm Publishers, Incorporated. ISBN 978-0-7136-6418-8. 
  1. ^ BirdLife International (2012). "Ramphastos tucanus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ [1]
  3. ^ Lester Short; Jennifer F. M. Horne (2001). Toucans, Barbets, and Honeyguides: Ramphastidae, Capitonidae and Indicatoridae. Oxford University Press. ISBN 978-0-19-854666-5. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!