Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos tucanus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTCTACGTTATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTAAGTCTCCTCATCCGAGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTCACCGCCCACGCGTTCGTAATAATCTTCTTCATGGTTATACCCATCATAATCGGGGGCTTTGGCAACTGGCTCGTCCCTCTAATAATCGGAGCCCCAGACATAGCTTTCCCACGCATAAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTCCTCGCTTCATCCACAGTCGAAGCTGGGGCCGGGACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTTGACCTAGCCATCTTCTCCCTACATTTAGCGGGAGTTTCATCCATCCTAGGTGCAATCAACTTCATCACCACCGCCATCAACATAAAACCACCAGCCATCTCACAATACCAAACACCACTGTTTGTCTGATCCGTACTCATCACTGCCGTCCTACTTCTTTTATCCCTCCCCGTCCTCGCCGCAGGCATCACCATACTCCTCACCGATCGCAATCTAAACACCACATTCTTTGACCCAGCTGGGGGAGGTGACCCTGTCCTATATCAACACCTCTTCTGATTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos tucanus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 5
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Not Recognized
  • 2000
    Not Recognized
  • 1994
    Not Recognized
  • 1988
    Not Recognized
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'common' (Stotz et al. (1996).
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

White-throated Toucan

At first this may resemble a Cuvier's Toucan, R. t. cuvieri, but a closer look reaveals a brownish patch on the upper part of the mandible, identifying it as a tucanus-cuvieri intergrade.
Red-billed Toucan
Ramphastos t. tucanus

The White-throated Toucan (Ramphastos tucanus) is a near-passerine bird found throughout the Amazon in south-eastern Colombia, eastern Ecuador, eastern Peru, northern Bolivia, southern and eastern Venezuela, northern and western Brazil, including the Amazon Basin's adjacent Tocantins-Araguaia River drainage, and the Guianas. It prefers tropical humid forest, but also occurs in woodland and locally in riverine forest within the Cerrado.

It was formerly considered to be two species, with the southern and western nominate subspecies, R. t. tucanus, named the Red-billed Toucan, and the northern and eastern subspecies, R. t. cuvieri, Cuvier's Toucan (when considered a species; R. cuvieri, Wagler, 1827). However, the two subspecies, which differ principally in the bill colour, interbreed freely wherever they meet and therefore merit only subspecies status. The subspecies R. t. inca from Bolivia is of questionable validity and may represent a stable hybrid population between tucanus and culminatus.

Contents

Description [edit]

Like other toucans, the White-throated Toucan is brightly marked and has a huge bill. It has a total length of 50–61 cm (20–24 in).[2] Body weight is somewhat variable, ranging in adult birds from 425 to 830 g (0.94 to 1.8 lb). The male averages slightly larger, at a mass of 642 g (1.42 lb), while the female averages 580 g (1.3 lb). Among standard measurements, the wing chord is 20.4 to 26.5 cm (8.0 to 10.4 in), the bill is 12.2 to 22 cm (4.8 to 8.7 in), the tail is 13.3 to 16.8 cm (5.2 to 6.6 in), and the tarsus is 4.5 to 5.6 cm (1.8 to 2.2 in).[3] The only species of toucan that surpasses the White-throated in size is the Toco Toucan.

It has black plumage with a white throat and breast bordered below with a narrow red line. The rump is bright yellow and the crissum is red. The bare skin around the eye is blue. The bill has a yellow tip, upper ridge and base of the upper mandible, and the base of the lower mandible is blue. The rest of the bill is mainly black in R. t. cuvieri and mainly reddish-brown in R. t. tucanus, with intergrades showing a mixed coloration. Males are larger and longer-billed than females, but otherwise the sexes are alike.

Juveniles are noticeably shorter-billed, more sooty-black, and have duller plumage.

The White-throated Toucan of the race cuvieri is virtually identical to the related Channel-billed Toucan of the race culminatus, but the latter is smaller and has a proportionally shorter bill with a more strongly keeled culmen. The call is often the best distinction between the species. White-throated has a yelping eeoo, hue hue, whereas Channel-billed has a croaking song.

Behaviour [edit]

Small flocks or more commonly pairs of birds move through the forest with a heavy, rather weak, undulating flight, rarely flying more than 100 m (330 ft) at a time. This species is primarily an arboreal fruit-eater, but will also take insects, lizards, eggs, and small birds.

Breeding [edit]

The 2–4 white eggs are laid in an unlined cavity high in a decayed section of a living tree, or in an old woodpecker nest in a dead tree.

Both sexes incubate the eggs for at 14–15 days, and the toucan chicks remain in the nest after hatching. They are blind and naked at birth, with short bills, and have specialised pads on their heels to protect them from the rough floor of the nest. They are fed by both parents, and fledge after about 6 weeks. The parents continue feeding the juveniles for several weeks after they have left the nest.

References [edit]

  1. ^ BirdLife International (2012). "Ramphastos tucanus". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. Retrieved 16 July 2012. 
  2. ^ [1]
  3. ^ Toucans, Barbets and Honeyguides (Bird Families of the World) by Lester Short & Jennifer Horne. Oxford University Press (2001), ISBN 978-0198546665.
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!