Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos vitellinus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 4 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACCTTCACCAATCGATGATTATTCTCCACCAACCACAAAGATATTGGCACCCTCTACCTCATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTAAGTCTCCTCATCCGAGCAGAACTTGGTCAACCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTTACTGCCCACGCATTCGTAATAATCTTCTTCATAGTCATACCCATCATAATCGGAGGCTTTGGCAATTGACTTGTTCCCCTAATAATCGGGGCCCCCGACATGGCCTTCCCACGCATGAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTTCTCGCCTCATCCACAGTCGAAGCTGGGGCCGGAACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTCGACCTAGCCATCTTCTCCTTACATTTGGCAGGAGTTTCATCCATCCTAGGTGCAATCAACTTCATCACCACTGCCATCAACATAAAACCACCAGCCATCTCACAATATCAGACACCACTGTTCGTCTGATCTGTACTCATCACTGCCGTCCTACTCCTTCTTTCCCTCCCCGTCCTCGCCGCAGGCATCACTATACTCCTCACCGATCGCAATCTAAACACCACATTCTTCGACCCAGCTGGAGGAGGTGACCCTGTCCTATATCAACATCTCTTCTGATTCTTCGGTCACCCCGAAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos vitellinus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 4
Specimens with Barcodes: 5
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size has not been quantified, but it is not believed to approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population
The global population size has not been quantified, but this species is described as 'fairly common' (Stotz et al. (1996).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Channel-billed toucan

The channel-billed toucan (Ramphastos vitellinus) is a near-passerine bird which breeds in Trinidad and in tropical South America as far south as southern Brazil and central Bolivia.

Taxonomy[edit]

The subspecies were previously considered separate species, but all interbreed freely wherever they meet. These are the yellow-ridged toucan (R. culminatus; now R. vitellinus culminatus), the citron-throated toucan (R. citreolaemus; now R. vitellinus citreolaemus) and the Ariel toucan (R. ariel; now R. vitellinus ariel). However, the subspecies R. v. ariel is closer to R. v. culminatus than to the nominate, and are by some already considered close to distinct species status. As R. v. ariel was described before R. v. culminatus, if separated they would become Ramphastos ariel ariel and R. a. culminatus. There also exists an isolated population in eastern Brazil. It looks very similar to, and has traditionally been considered part of, R. v. ariel, but molecular analysis suggests that it has been isolated for a long time and is a yet-undescribed separate subspecies or possibly even species (Weckstein, 2005).

Description[edit]

R. v. vitellinus in captivity
Juvenile R. v. culminatus

Like other toucans, the channel-billed is brightly marked and has a huge bill. It is typically 48 cm (19 in) long with a 9–14 cm (3½-5½ in) bill. It weighs 300-430 grams (10.6-15.2 oz.)[2]

  • Nominate race (R. v. vitellinus): Its upperparts, belly, tail and most of the bill are black, and the uppertail and undertail coverts are red. The bare eye-patch and bill base are blue, the throat is white, most of the central breast is yellow-orange fading to white laterally and the lower breast sharply contrasts with a broad transverse red band. The iris is dark brownish. It is found in the north-eastern part of this species' range.
R. v. culminatus
  • Race culminatus: It resembles the nominate, but has a yellow base of the upper mandible and ridge to its bill, orange-yellow uppertail coverts and the throat and breast are white (occasionally tinged yellow), with just a narrow red band separating the latter from the black belly. It occurs in the eastern and south-central part of this species' range. It is very similar to, and easily confused with, Cuvier's toucan (Ramphastos tucanus cuvieri).
R. v. ariel
Mating at Birds of Eden, South Africa
  • Race ariel: It resembles the nominate, but the base of its bill is yellow, the skin around the pale blue eye is red and the entire throat and chest are orange. It occurs in the south-east Amazon. The unnamed population from the coastal regions of eastern Brazil is virtually identical.
  • Race citreolaemus. It resembles culminatus, but with a clear yellow tinge to the throat, a green tinge to the otherwise yellow culmen, a yellow-orange patch at the very base of the bill, and a pale bluish iris. It occurs in northern Colombia and north-western Venezuela.

Wherever the distributions of the subspecies meet, individuals with features that are intermediate compared to above described races are common due to hybridization. Some of these intermediate populations have sometimes been awarded subspecies status, e.g. theresae for the population in north-eastern Brazil and pintoi for populations in south-central Brazil (both are culminatus-ariel intergrades).

Habitat[edit]

Found in forest and woodland. Prefers humid regions, but locally extends into drier regions (esp. along rivers). Mainly in lowlands, but locally to an altitude of 1700 m (5600 ft).

Behavior[edit]

This species is an arboreal fruit-eater, but will take insects small reptiles, eggs, and frogs. The call is a croaking cree-op cree-op cree-op.

The parents are both active in raising the young. The white eggs are laid in a high unlined tree cavity. There is have a gestation period of 18 days, and the parents both incubate for 15 to 16 days. However, they can be impatient sitters, often leaving their eggs uncovered for hours at a time. Newborn toucans remain in the nest after hatching. They are blind and naked at birth, and their eyes open after about 3 weeks. They have short bills and specialized pads on their heels to protect them from the rough floor of the nest. The feathers do not begin to expand until they are nearly 4 weeks old. They are helpless and unable to leave the nest for about 8 weeks, dependent upon both parents to feed them. After this, the young can care for themselves. They begin to leave the nest after 40 to 50 days, depending on size.

References[edit]

  • Hilty, Steven L. (2002): Birds of Venezuela. ISBN 0-7136-6418-5
  • Weckstein, Jason D. (2005): Molecular Phylogenetics of the Ramphastos Toucans: Implications for the Evolution of Morphology, Vocalizations, and Coloration. Auk 122(4): 1191–1209. PDF fulltext. Erratum in Auk 123(2): 610 (2006).
  • ffrench, Richard (1991). A Guide to the Birds of Trinidad and Tobago (2nd edition ed.). Comstock Publishing. ISBN 0-8014-9792-2. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!