Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Ramphastos sulfuratus occurs from South Mexico to North Colombia and Northeast Venezuela (Kricher 1989).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Ramphastos sulfuratus is a large (about 20 inches or 52 cm long) colorful bird, and has a bill that can grow to be up to one third the size of its body (Enchantedlearning, 1999). The large banana-shaped bill is the most distinguishing feature of R. sulferatus, and is surprisingly lightweight for its size (Kricher, 1989). The light weight of the keratin-composed bill is due to its hollow, bone-reinforced construction (Kricher, 1989; Enchantedlearning, 1999; Thurman, 1999). The bill is edged with tooth-like ridges. Housed within the bill is a long, narrow, feather-like tongue. The body of R. sulfuratus is black, and it has a bright yellow bib and cheeks. Its rump is white, and the undertail coverts are a brilliant red. The area directly around the eyes is bare, showing the pale blue skin underneath. Its bill, which takes up the entire front of its head, is green, with a bright orange blaze on the side, red on the tip of the upper mandible, and blue on the tip of the lower mandible. Males and females share the same coloration and large bill, the only difference being that the male is slightly larger than the female. Ramphastos sulfuratus has blue legs and its toes are arranged in the zygodactyl pattern (with two toes forward and two toes back)(Kricher, 1989; Greer, 1993; Beletsky, 1998). Its tail is long and square-shaped, and its wings are wide and short to enable flight through trees (Beletsky, 1998).

Ramphastos sulfuratus is one of the larger species of toucans, weighing about 400 grams. There are several species of toucan, distinguished mainly by beak size, body size and body coloring. The behavioral characteristics of all toucan species are largely similar (Emerald Forest).

Average mass: 400 g.

Other Physical Features: endothermic ; bilateral symmetry

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ramphastos sulfuratus lives in lowland forests and on forest borders (Kricher, 1989; Belize, 2000).

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

The diet of R. sulfuratus consists primarily of fruit, but it will also consume the eggs or fledglings of other birds, insects, small lizards and tree frogs. By eating these non-fruit items, R. sulfuratus increases its protein intake. This toucan travels in flocks of 6 to 12, eating fruit as it goes. Eating the fruit whole by snapping its head back and gulping down, R. sulfuratus can regurgitate large seeds unharmed. Small seeds are passed through the bird's digestive tract, also unharmed. In this way, the seeds are dispersed far from the parent plant. Although the function of the bill of R. sulfuratus is not fully understood, it does make a very good tool for plucking fruit off branches that are too small to bear the weight of the bird (Kricher, 1987; Remsen, 1993; Beletsky, 1998; Enchantedlearning, 1999).

Ramphastos sulfuratus is spotted feeding mainly in high canopy, and will only fly down occasionally to feed on shrubs or to snatch a reptilian food item from the forest floor (Beletsky, 1998).

The Chestnut-mandibled Toucan may sometimes 'parasitize' R. sulfuratus by following R. sulfuratus to a fruit-filled tree, and then chasing the smaller bird (R. sulfuratus) away (Beletsky, 1998).

Animal Foods: reptiles

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Ramphastos sulfuratus nests in natural or wood-pecker made tree cavities and lays clutches of 2 to 4 white glossy eggs. They can have up to 2 or 3 broods in a year. Both parents share the responsibility of incubating the eggs and feeding the chicks once they hatch. The altricial chicks hatch after 16 to 20 days of incubation. They remain in the nest for 8 to 9 weeks so that their beaks may fully form (Kricher, 1989; Enchantedlearning, 1999).

Ramphastos sulfuratus is apparently monogamous. Sometimes a mated pair will defend a fruit tree from other toucans and other frugivorous birds. They defend the tree by threat displays and sometimes, if the other bird is also a toucan, by bill clashes (Beletsky, 1998).

The brightly colored bill of R. sulfuratus probably does not have a great deal to do with mate selection, as both male and females share the same large beak and the same bright coloration. The coloration is probably more of a camouflage in the brightly colored tropical regions where R. sulfuratus resides (Kricher, 1989; Beletsky, 1998).

Breeding interval: They can have up to 2 or 3 broods in a year.

Range eggs per season: 2 to 4.

Range time to hatching: 16 to 20 days.

Range fledging age: 8 to 9 weeks.

Key Reproductive Features: iteroparous ; year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos sulfuratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTCATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTGAGTCTCCTCATCCGAGCAGAGCTTGGCCAGCCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTTACCGCCCACGCATTCGTAATAATCTTCTTCATAGTTATGCCTATTATAATCGGAGGCTTTGGCAACTGACTCGTTCCCCTAATAATCGGAGCCCCCGACATAGCCTTCCCACGCATGAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTCCTTGCCTCATCCACAGTCGAAGCTGGAGCCGGAACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTCGATCTGGCCATCTTCTCCTTACATTTAGCAGGAGTCTCATCCATCCTCGGTGCAATCAATTTCATCACCACCGCCATCAACATAAAACCACCAGCCATCTCACAATATCAAACACCACTATTCGTCTGATCCGTACTCATCACTGCCGTACTACTTCTTCTTTCCCTCCCCGTCCTCGCCGCAGGCATCACTATACTCCTCACTGATCGTAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGTGACCCCGTCCTATATCAACATCTCTTCTGATTCTTT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos sulfuratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5