Articles on this page are available in 1 other language: Spanish (19) (learn more)

Overview

Distribution

Geographic Range

Ramphastos sulfuratus occurs from South Mexico to North Colombia and Northeast Venezuela (Kricher 1989).

Biogeographic Regions: neotropical (Native )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Ramphastos sulfuratus is a large (about 20 inches or 52 cm long) colorful bird, and has a bill that can grow to be up to one third the size of its body (Enchantedlearning, 1999). The large banana-shaped bill is the most distinguishing feature of R. sulferatus, and is surprisingly lightweight for its size (Kricher, 1989). The light weight of the keratin-composed bill is due to its hollow, bone-reinforced construction (Kricher, 1989; Enchantedlearning, 1999; Thurman, 1999). The bill is edged with tooth-like ridges. Housed within the bill is a long, narrow, feather-like tongue. The body of R. sulfuratus is black, and it has a bright yellow bib and cheeks. Its rump is white, and the undertail coverts are a brilliant red. The area directly around the eyes is bare, showing the pale blue skin underneath. Its bill, which takes up the entire front of its head, is green, with a bright orange blaze on the side, red on the tip of the upper mandible, and blue on the tip of the lower mandible. Males and females share the same coloration and large bill, the only difference being that the male is slightly larger than the female. Ramphastos sulfuratus has blue legs and its toes are arranged in the zygodactyl pattern (with two toes forward and two toes back)(Kricher, 1989; Greer, 1993; Beletsky, 1998). Its tail is long and square-shaped, and its wings are wide and short to enable flight through trees (Beletsky, 1998).

Ramphastos sulfuratus is one of the larger species of toucans, weighing about 400 grams. There are several species of toucan, distinguished mainly by beak size, body size and body coloring. The behavioral characteristics of all toucan species are largely similar (Emerald Forest).

Average mass: 400 g.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ramphastos sulfuratus lives in lowland forests and on forest borders (Kricher, 1989; Belize, 2000).

Terrestrial Biomes: forest ; rainforest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

The diet of R. sulfuratus consists primarily of fruit, but it will also consume the eggs or fledglings of other birds, insects, small lizards and tree frogs. By eating these non-fruit items, R. sulfuratus increases its protein intake. This toucan travels in flocks of 6 to 12, eating fruit as it goes. Eating the fruit whole by snapping its head back and gulping down, R. sulfuratus can regurgitate large seeds unharmed. Small seeds are passed through the bird's digestive tract, also unharmed. In this way, the seeds are dispersed far from the parent plant. Although the function of the bill of R. sulfuratus is not fully understood, it does make a very good tool for plucking fruit off branches that are too small to bear the weight of the bird (Kricher, 1987; Remsen, 1993; Beletsky, 1998; Enchantedlearning, 1999).

Ramphastos sulfuratus is spotted feeding mainly in high canopy, and will only fly down occasionally to feed on shrubs or to snatch a reptilian food item from the forest floor (Beletsky, 1998).

The Chestnut-mandibled Toucan may sometimes 'parasitize' R. sulfuratus by following R. sulfuratus to a fruit-filled tree, and then chasing the smaller bird (R. sulfuratus) away (Beletsky, 1998).

Animal Foods: reptiles

Plant Foods: fruit

Primary Diet: herbivore (Frugivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Reproduction

Ramphastos sulfuratus nests in natural or wood-pecker made tree cavities and lays clutches of 2 to 4 white glossy eggs. They can have up to 2 or 3 broods in a year. Both parents share the responsibility of incubating the eggs and feeding the chicks once they hatch. The altricial chicks hatch after 16 to 20 days of incubation. They remain in the nest for 8 to 9 weeks so that their beaks may fully form (Kricher, 1989; Enchantedlearning, 1999).

Ramphastos sulfuratus is apparently monogamous. Sometimes a mated pair will defend a fruit tree from other toucans and other frugivorous birds. They defend the tree by threat displays and sometimes, if the other bird is also a toucan, by bill clashes (Beletsky, 1998).

The brightly colored bill of R. sulfuratus probably does not have a great deal to do with mate selection, as both male and females share the same large beak and the same bright coloration. The coloration is probably more of a camouflage in the brightly colored tropical regions where R. sulfuratus resides (Kricher, 1989; Beletsky, 1998).

Breeding interval: They can have up to 2 or 3 broods in a year.

Range eggs per season: 2 to 4.

Range time to hatching: 16 to 20 days.

Range fledging age: 8 to 9 weeks.

Key Reproductive Features: year-round breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Ramphastos sulfuratus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 3 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTACCTCATCTTCGGCGCATGAGCAGGCATAATCGGCACAGCCCTGAGTCTCCTCATCCGAGCAGAGCTTGGCCAGCCAGGAACCCTCCTGGGCGACGACCAAATCTACAACGTAATTGTTACCGCCCACGCATTCGTAATAATCTTCTTCATAGTTATGCCTATTATAATCGGAGGCTTTGGCAACTGACTCGTTCCCCTAATAATCGGAGCCCCCGACATAGCCTTCCCACGCATGAACAACATAAGCTTCTGACTCCTCCCCCCATCATTCCTCCTCCTCCTTGCCTCATCCACAGTCGAAGCTGGAGCCGGAACCGGATGAACTGTTTACCCCCCTCTAGCCGGTAACCTAGCCCATGCCGGAGCCTCAGTCGATCTGGCCATCTTCTCCTTACATTTAGCAGGAGTCTCATCCATCCTCGGTGCAATCAATTTCATCACCACCGCCATCAACATAAAACCACCAGCCATCTCACAATATCAAACACCACTATTCGTCTGATCCGTACTCATCACTGCCGTACTACTTCTTCTTTCCCTCCCCGTCCTCGCCGCAGGCATCACTATACTCCTCACTGATCGTAACCTAAACACTACATTCTTCGACCCAGCTGGAGGAGGTGACCCCGTCCTATATCAACATCTCTTCTGATTCTTT
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Ramphastos sulfuratus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 3
Specimens with Barcodes: 7
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has a very large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is very large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ramphastos sulfuratus is not immediately threatened, but it is CITES listed, because it is considered to be a look-alike of threatened species, and therefore needs to be monitored. The species is a common resident in areas where it occurs (its range), except where there is heavy deforestation. There are some areas where R. sulfuratus is locally scarce due to hunting (to eat or/and for ornaments). Toucan feathers have been used as ornaments for a long time (Beletsky, 1998).

Ramphastos sulfuratus, like many other species of toucan, is a popular pet, due to its brightly colored bill and its intelligence. At one time, animals were taken from the wild and kept as pets. Now, there are organizations, which specialize in hand-rearing R. sulfuratus for the pet market (or parent-rearing for use in other breeding programs), so this factor does not have as great effect on the conservation status as in the past (Beletsky, 1998; Emerald Forest).

In some areas of Belize, Guatemala, and Costa Rica, R. sulfuratus is allowed to fly loose around people's homes, free to come and go as it pleases (Emerald Forest).

CITES: appendix ii

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
Partners in Flight estimate the total population to number 50,000-499,999 individuals (A. Panjabi in litt. 2008).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Positive

The Keel-billed Toucan is the national bird of Belize. It is responsible for bringing in much of the tourism there (Belize, 2000; Greer, 1993).

Humans have, as mentioned above, hunted R. sulfuratus for meat, and sport (keeping the feathers as ornamentation). They have also captured this species for the pet market (Beletsky, 1998).

Also, 'Toucan Sam', the cartoon used to advertise Fruit Loops cereal is sometimes identified (incorrectly) as a Keel-billed (Emerald Forest).

Positive Impacts: pet trade ; food ; body parts are source of valuable material; ecotourism

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Keel-billed toucan

The Keel-billed Toucan (Ramphastos sulfuratus), also known as Sulfur-breasted Toucan or Rainbow-billed Toucan, is a colorful Latin American member of the toucan family. It is the national bird of Belize.[2]

Description[edit]

Keel-billed Toucan in Las Pumas Zoo, Costa Rica

Including its bill, the Keel-billed Toucans ranges in length from around 42 to 55 cm (17 to 22 in).[3] Their large and colorful bill averages around 12–15 cm (4.7–5.9 in), about one-third of its length. It typically weighs about 380–500 g (13–18 oz).[4] While the bill seems large and cumbersome, it is in fact a spongy, hollow bone covered in keratin, a very light and hard protein.

The plumage of the Keel-billed Toucan is mainly black with a yellow neck and chest.They are very beautiful creatures. Molting occurs once per year.[5] It has blue feet and red feathers at the tip of its tail. The bill is mainly green with a red tip and orange sides.

Keel-billed toucans have zygodactyl feet (or feet with toes facing in different directions) – two toes face forward and two face back. Because toucans spend a large portion of time in the trees, this helps the birds to stay on the branches of the trees and jump from one branch to another.

Distribution and ecology[edit]

The Keel-billed Toucan can be found from Southern Mexico to Venezuela and Colombia. It roosts in the canopies of tropical, subtropical, and lowland rainforests, up to altitudes of 1,900 m (6,200 ft).[6] It roosts in holes in trees,[5] often with several other toucans. This can be very cramped, so the birds tuck their tails and beaks under their bodies to conserve space while sleeping. Adding to the lack of space, the bottoms of the holes are often covered with pits from the fruit the toucans have eaten.[5]

Like many toucans, Keel-billed Toucans are very social birds, rarely seen alone. It travels in small flocks of approximately six to twelve individuals through lowland rainforests; it is a poor flyer, and moves mostly by hopping through trees. It has a family structure within the group. Birds will often "duel" with each other using their bills, and throw fruit into each other's mouths. Keel-billed Toucans live together in these groups, often sharing cramped living quarters of holes in trees. Able to utilize human-altered habitat to some extent,[7] this widespread bird is considered to be a Species of Least Concern by the IUCN.[1] However, they are still threatened by hunting for their meat & beaks

Food and feeding[edit]

The diet of Keel-billed Toucans consists mostly of a wide range of fruit,[8] but may also include insects, eggs, nestlings and lizards, as well as small birds. The bill, surprisingly dexterous, allows this toucan to utilize a large variety of fruit that might not otherwise be reached. When eating the fruit, it uses its bill to dissect the fruit, and then tosses its head back to swallow the fruit whole.

Breeding[edit]

The female Keel-billed Toucan will lay 1–4 white eggs in a natural or already-made tree cavity.[9] The male and female share in the caring of the eggs, both taking turns incubating.[5] The eggs hatch approximately 15–20 days after being laid. After hatching, the male and female again take turns feeding the chicks. When the chicks hatch, they have no feathers, and have their eyes closed for approximately 3 weeks. The chicks have adequately formed heel pads, which assist on the pit-covered bottom of the nest.[5] The chicks stay in their nest for approximately eight to nine weeks while their bills develop fully and they are ready to fledge from the nest.

Aviculture[edit]

The Keel-billed Toucan is sometimes kept in captivity, but has a high fruit diet and is sensitive to hemochromatosis (an iron storage disease).[10]

Footnotes[edit]

  1. ^ a b BirdLife International (2012). "Ramphastos sulfuratus". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Government of Belize: About Belize – National Symbols. Retrieved 2007-02-08.
  3. ^ Skutch (1971)
  4. ^ "Keel-billed Toucan, Costa Rica – information, where to see it, and photos". Anywherecostarica.com. Retrieved 2013-03-05. 
  5. ^ a b c d e Van Tyne (1929)
  6. ^ Strewe & Navarro (2004)
  7. ^ Foster (2007)
  8. ^ E.g. Cymbopetalum mayanum (Annonaceae) and Gumbo-limbo (Bursera simaruba): Van Tyne (1929), Foster (2007).
  9. ^ Keel-Billed Toucan Ramphastos sulfuratus. The Sacramento Zoological Society. saczoo.com
  10. ^ Otten, Benjamin A.; Orosz, Susan E.; Auge, Shannon; Frazier, Donita L. (2001). "Mineral Content of Food Items Commonly Ingested by Keel-Billed Toucans (Ramphastos sulfuratus)". Journal of Avian Medicine and Surgery 15 (3): 194. doi:10.1647/1082-6742(2001)015[0194:MCOFIC]2.0.CO;2. 

References[edit]

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!