Articles on this page are available in 1 other language: Chinese (Simplified) (7) (learn more)

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Observations: Little is known about the longevity of these animals, but they have been reported to live up to 5.4 years in the wild (http://www.euring.org/data_and_codes/longevity.htm). Considering the longevity of similar species, maximum longevity could be significantly underestimated.
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Picus canus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 28
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Picus canus

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

AATCGATGATTATTCTCCACCAACCACAAAGATATCGGCACTCTATATCTCATCTTTGGTGCATGAGCCGGCATGATCGGCACAGCCCTTAGCCTCCTAATCCGAGCTGAACTTGGTCAACCCGGCACCCTTCTCGGCGAT---GACCAAATCTACAACGTCATCGTCACTGCCCATGCATTCGTAATAATCTTCTTCATAGTTATACCCATTATGATCGGGGGGTTCGGAAATTGACTCGTACCCCTCATAATCGGAGCCCCTGACATAGCATTTCCACGAATAAACAACATAAGCTTTTGACTCCTCCCACCATCATTCCTCCTCCTTCTAGCCTCCTCCACAGTAGAAGCGGGAGCAGGAACAGGCTGAACCGTCTACCCACCCCTTGCTGGCAACCTAGCCCACGCAGGAGCTTCAGTCGACCTGGCCATTTTCTCACTCCACCTAGCAGGCATCTCATCCNTCTTAGGAGCAATCAACTTCATTACTANGGGCNTCAACATAAAACCCCCNGCCCTCTCANAATANNAAACCCCCCTATTTGTNTGATCCGTCCTCATCACCGCGGTCCTCCTCCTCTTATCCCTTCCAGTCCTTGCCGCTGGCATTACCATACTCCTCACAGATCGTAACTTAAACACCACGTTCTTCGATCCCGCTGGAGGGGGCGACCCCATTCTCTACCAACATCTCTTCTGATTCTTTGGTCACCCCGAAGTCTACATCCTCATCCTCCCAGGATTTGGCATTATCTCCCACGTNNTAGCATACTACGCCGGTAAAAAAGAACCCTTTGGCTATATGGGTATGGTATGAGCCATACTATCCATCGGATTCCTCGGCTTTATCGTATGAGCCCACCACATATTTACCGTGGGAATAGACGTAGATACCCGAG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 180,000-320,000 breeding pairs, equating to 540,000-960,000 individuals (BirdLife International 2004). Europe forms 5-24% of the global range, so a very preliminary estimate of the global population size is 2,250,000-19,200,000 individuals, although further validation of this estimate is needed. National population estimates include: c.100-10,000 breeding pairs in China; c.100-10,000 breeding pairs in Taiwan; c.100-100,000 breeding pairs in Korea; c.100-10,000 breeding pairs in Japan and c.100-100,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Grey-headed woodpecker

The Grey-headed Woodpecker (Picus canus), also known as the Grey-faced Woodpecker, is a Eurasian member of the woodpecker family Piciformes.

Description[edit]

It is 25–28 cm long and weighs 130-180 grams. Its plumage closely resembles its near relative the European Green Woodpecker. It has green upperparts, pale grey underparts and a yellow rump. It has a grey head with black moustache, and the male has a red crown. It has a shorter neck, slimmer bill and slightly rounder head than the Green Woodpecker.

Behaviour[edit]

Eggs of Picus canus

Grey-headed woodpeckers live in leaf forests and mixed forests. They breed in May and lay five to ten eggs which are brought up by both parents. The young hatch after 15–17 days, and learn to fly in four weeks.

In summer, the grey-headed woodpecker eats maggots, beetle larvae and other insects. In winter it takes seeds, and can even come to garden feeding places, especially if fat is offered.

Grey-headed Woodpecker.jpg
Call from the Central Himalayas

Name[edit]

The Sibley-Monroe checklist has two birds called "Grey-headed Woodpecker", Picus canus and Dendropicos spodocephalus (syn.Mesopicos goertae). For the latter, see Grey Woodpecker.

References[edit]


Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!