Overview

Brief Summary

Sialia sialis

A small (7 inches) thrush, the male Eastern Bluebird is most easily identified by its deep blue head and back, red breast, and white belly. Female Eastern Bluebirds are similar to males, but are a duller gray-blue on the head and back. This species is unmistakable across much of its range, but Western Bluebirds (Sialia mexicana), which occur in southern Arizona and as vagrants on the western Great Plains, are of similar size and color. The Eastern Bluebird breeds across much of the eastern United States and southern Canada. In winter, northerly-breeding populations migrate to the southern U.S.and northern Mexico, while southerly-breeding populations are non-migratory. Other non-migratory populations exist in Mexico and Central America, one of which extends north into extreme southern Arizona. Eastern Bluebirds historically inhabited variety of open woodland habitats. In modern times, this species has expanded into human-altered environments such as orchards, shrubby agricultural fields, and large yards in suburban areas. Eastern Bluebirds primarily eat fruits, berries, and small invertebrates. In appropriate habitat, Eastern Bluebirds may be observed flying down to the ground from perches in pursuit of prey. In many areas during the breeding season, this species is most easily located by looking for pole-mounted nest boxes in open areas: wherever these nest boxes are found, there are likely Eastern Bluebirds around. This species is primarily active during the day.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: Breeding range extends from southern Saskatchewan east across southern Canada to Nova Scotia, and south to Nicaragua, the North American Gulf Coast, southern Florida, and Bermuda, and west to the western Great Plains; also southeastern Arizona. Winter range extends from the middle portions of the eastern United States south through the breeding range and western Cuba.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

This species has a very broad range. It is found east of the Rocky Mountains, spanning from southern Canada to the Gulf states and on into Mexico and Honduras. There are also populations found in Cuba, although it is not a native species there.

Biogeographic Regions: nearctic (Native )

  • Terres, J. 1980. The Audubon Society: Encyclopedia of North American Birds. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America


AL AK AZ AR CO CT DE FL GA IL
IN IA KS KY LA ME MD MA MI MN
MS MO MT NE NH NJ NY NC ND OH
OK PA RI SC SD TN TX UT VT VA
WV WI WY DC
MB NB NF NS ON PE PQ SK
MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eastern Bluebirds are native to the Nearctic region. They are found east of the Rocky Mountains from southern Canada to the Gulf states and into Mexico and Honduras. Humans have introduced these bluebirds to Cuba.

Biogeographic Regions: nearctic (Native )

  • Terres, J. 1980. The Audubon Society: Encyclopedia of North American Birds. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds breed from southern Saskatchewan east to southern Nova
Scotia and south through the eastern United States [2].  In the West it
occurs casually along the eastern foothills of the Rocky Mountains in
Montana, Wyoming, and Colorado, more commonly in the Dakotas through
central Nebraska, central Kansas, and central Oklahoma to central and
southeastern Texas, and south to most of Mexico [41,70].  Eastern
bluebird was listed in 1969 as a species whose present occurrence in
Arizona is limited, unknown, or only suspected [64], although more
recent work [46] lists Arizona as within its range.

Eastern bluebirds winter in the middle parts of the United States south
to Nuevo Leon, the Gulf Coast, and southern Florida, and rarely to
western Cuba [2].

Ranges of subspecies are as follows:

Florida bluebird:  Resident throughout peninsular Florida

Tamaulipas bluebird:  Tamaulipas north to the Rio Grande valley in
south-central Texas 

Azure bluebird:  Transition zone from the mountains of southern Arizona
south to Jalisco, Oaxaca, and Vera Cruz (Guerrero).  Winters south to
northern Guatemala [2,6].
  • 2. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 6. Bent, Arthur Cleveland. 1964. Life histories of North American thrushes, kinglets, and their allies. New York: Dover Publications, Inc. 452 p. [24782]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 64. Todd, Richard L. 1969. Nongame investigations. Project W-53-R-19. Work Plan 5: Job 1. Completion Report. Tucson, AZ: Arizona Fish and Game Department. 26 p. [7295]
  • 70. Witzeman, Janet; Hubbard, John P.; Kaufman, Kenn. 1976. Southwest region. American Birds. 30(5): 985-990. [25062]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eastern bluebirds are small birds with short, slender beaks and short legs. They are brightly colored, with a blue upper body, red breast, and white abdomen. Males have wing and tail feathers that are blue with black or gray shafts and tips. Their heads are a lighter shade of blue, which fades into a red throat and breast area. The breast and belly are white with light blue tips on some of the longer feathers. Females also exhibit this pattern of coloration, although they tend to be duller than males and have more gray. Adult weight ranges from 27 to 34 grams. They are, on average 18 cm long from the tip of their beak to the end of their tail.

Young bluebirds are grayish in color. They have speckled breasts and their wings are tipped in blue. The blue color becomes much more prominent and the speckles on their breast disappear as they become adults.

There are eight recognized subspecies of Sialia sialis. These subspecies are distinguished based on coloration and geographic range.

Range mass: 27 to 34 g.

Range length: 16 to 21 cm.

Average length: 18 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Eastern bluebirds are small birds with short, slender beaks and short legs. They are brightly colored, with a blue upper body, red breast, and white belly. Males have wing and tail feathers that are blue with black or gray shafts and tips. Females look similar to males, but are usually duller in color and are slightly larger.

Adult eastern bluebirds weigh 27 to 34 grams. They are about 18 cm long from the tip of their beak to the end of their tail.

Young bluebirds are grayish in color. They have speckled breasts and their wings have blue tips. As they become adults, the blue color becomes much more obvious, and speckles on their breast disappear.

Range mass: 27 to 34 g.

Range length: 16 to 21 cm.

Average length: 18 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Weight: 32 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Eastern bluebirds prefer open land with scattered trees for perching, nesting, and feeding. They are often seen in parks, gardens, hedges, and other areas that provide perches. They are also commonly found sitting on fences and utility wires.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Habitat includes forest edge, open woodland, and partly open situations with scattered trees, from coniferous or deciduous forest to riparian woodland, also pine woodland or savanna in the tropics. Nests are in natural cavities, old woodpecker holes, bird boxes, or similar sites, mostly 3-20 feet (1-6 meters) above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: low-severity fire

Eastern bluebirds are found in a wide range of plant communities with
open overstories and in openings within woodlands.  They are usually
found at low elevations and are frequently observed in oak (Quercus
spp.) woodlands [46].  In southern Michigan, oak-pine (Pinus spp.)
woodlands frequented by eastern bluebirds were dominated by black oak
(Quercus velutina), pin oak (Q. palustris), northern red oak (Q. rubra),
white oak (Q. alba), eastern white pine (Pinus strobus), red pine (P.
resinosa), jack pine (P. banksiana), and Scotch pine (P. sylvestris).
Eastern bluebirds are also commonly found in old fields characterized by
hawthorns (Crataegus spp.), black walnut (Juglans nigra), black locust
(Robinia pseudoacacia), black cherry (Prunus serotina), chokecherry (P.
virginiana), staghorn sumac (Rhus typhina), and multiflora rose (Rosa
multiflora) [46].  Other eastern bluebird sites include the jack pine
plains of Huron National Forest, dominated by jack pine, northern pin
oak (Quercus ellipsoidalis), and scarlet oak (Q. coccinea).  Bracken
fern (Pteridium aquilinum), blueberries (Vaccinium spp.), and sweet fern
(Comptonia peregrina) are characteristic understory components [41].
Eastern bluebirds are also present in cutover and burned pine-oak
woodlands [46] and in Wisconsin jack pine savanna.  The latter habitat
type is maintained by frequent low-severity fire [68].  Eastern
bluebirds are common in regenerating stands of central and southeastern
oak-pine forests [17].

In western Virginia eastern bluebirds were observed in the Appalachian
Mountains in lower and midslope forests dominated by scarlet oak, black
oak, chestnut oak (Q. prinus), and white oak [11].

Wintering areas used by eastern bluebirds in the Apalachicola National
Forest included pasture, open longleaf pine (Pinus palustris) woods, and
pine-oak woodlands usually dominated by live oak (Q. virginiana) with
Spanish moss (Tillandsia usneoides) [41].
  • 11. Crawford, H. S.; Hooper, R. G.; Titterington, R. W. 1981. Songbird population response to silvicultural practices in central Appalachian hardwoods. Journal of Wildlife Management. 45(3): 680-692. [19282]
  • 17. Dickson, James G.; Thompson, Frank R., III; Conner, Richard N.; Franzreb, Kathleen E. 1993. Effects of silviculture on neotropical migratory birds in central and southeastern oak pine forests. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1993 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 374-385. [24663]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 68. Vora, Robin S. 1993. Moquah Barrens: pine barren restoration experiment initiated in Chequamegon National Forest. Restoration & Management Notes. 11(1): 39-44. [22359]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds prefer open land with scattered trees for perching, nesting, and feeding. They are often seen in parks, gardens, hedges, and other areas that provide perches. They are also commonly found sitting on fences and utility wires.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, natural, tree

Nesting:  Eastern bluebirds nest in tree cavities, nest boxes, and
crevices.  Many nests are built in abandoned woodpecker (Picidae) holes,
knotholes, and cavities formed by decay and/or fire wounds.  Eastern
bluebirds rarely nest in open situations.  In southern Michigan eastern
bluebirds apparently prefer nest boxes to natural cavities but fidelity
to one type of nest site is not strong.  Nest boxes may be more
attractive than natural cavities because they are usually placed in
suitable locations and have optimal dimensions.  Most changes from one
type of nest site to another occur after nest failures [45,48].

Most natural cavities used by eastern bluebirds are in oaks or American
elm (Ulmus americana) stubs [45,48].  Fire-scarred snags are also
commonly used [42].  In South Carolina longleaf pine-loblolly pine
stands, optimal d.b.h. of snags for cavity trees is 8 inches (20 cm)
[27].  In oak-pine woodlands the average height of cavities in pine
snags used by eastern bluebirds was 12 feet (3.6 m) and ranged from 1.7
to 55 feet (0.5-16.8 m).  Cavity depth averaged 7.8 inches (19.8 cm) and
ranged from 3 to 19 inches (7.6-48.8 cm), entrance diameter averaged 2.4
inches (6.1 cm) and ranged from 1.5 to 5.2 inches (3.7-13.3 cm), and
interior diameter averaged 3.6 inches (9.2 cm) and ranged from 2.2 to
6.3 inches (5.7-15.9 cm).  Entrance hole orientation does not affect
nest site use, although there is a slight tendency to choose cavities
facing southwest [41,42].

Foraging:  Perches near open areas, with an unobstructed view of air and
ground and sparse ground cover, are favored foraging sites.  Dead
branches are preferred over live ones, presumably for greater prey
visibility.  Where natural vegetation is tall, eastern bluebirds prefer
mowed areas to unmowed areas.  Areas with dry, nonfertile soils, low
vegetation, and much bare ground are also favored [22,46].

Roosting:  Night roosting sites are commonly in pine, oak, or pine-oak
woodlands with fairly large trees [41].  In winter, eastern bluebirds
use nest boxes for roosting only on very cold days (in Tennessee they
roosted in nest boxes on days when the temperature was 14 degrees
Fahrenheit [-10 deg C] or lower).  Numbers of eastern bluebirds in nest
box roosts ranged from 1 to 16 [50,51].
  • 22. Goldman, Peter. 1975. Hunting behavior of eastern bluebirds. Auk. 92: 798-801. [25044]
  • 27. Harlow, Richard F.; Guynn, David C., Jr. 1983. Snag densities in managed stands of the South Carolina coastal plain. Southern Journal of Applied Forestry. 7(4): 224-229. [12571]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 42. Pinkowski, Benedict C. 1976. Use of tree cavities by nesting eastern bluebirds. Journal of Wildlife Management. 40(3): 556-563. [25050]
  • 45. Pinkowski, Benedict C. 1977. Breeding adaptations in the eastern bluebird. Condor. 79: 289-302. [25052]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 48. Pinkowski, Benedict C. 1979. Nest site selection in eastern bluebirds. Condor. 81: 435-436. [25054]
  • 50. Pitts, T. David. 1979. Foods of eastern bluebirds during exceptionally cold weather in Tennessee. Journal of Wildlife Management. 43(3): 752-754. [19256]
  • 51. Pitts, T. David. 1981. Eastern bluebird population fluctuations in Tennessee during 1970-1979. Migrant. 52(2): 29-37. [25055]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: forbs, hardwood, presence, shrubs, succession

Nesting and Foraging Habitat:  Eastern bluebirds usually forage near the
nest site.  In Ohio eastern bluebirds traveled up to 1,320 feet (400 m)
from the nest on foraging trips [22].  Eastern bluebirds generally
prefer early successional habitats or open stands.  In Arkansas several
plots representing various stages of oldfield succession were surveyed
for birds.  Eastern bluebirds were observed only in burned fields and in
woody fields and not in more heavily wooded plots [58].  Within the
oak-hickory (Carya spp.) forest, eastern bluebirds prefer to nest in
savanna and savanna-like habitats such as pastures with scattered small
trees and bushes, usually near a lake or other body of water [55].  In
southern Michigan eastern bluebirds forage in open terrain [47].  They
are most commonly found in old fields dominated by forbs and grasses
with scattered trees and shrubs [44], oak and pine woodlands, open woods
with brushy undergrowth, areas of tall weeds, roads and roadsides,
recently plowed ground, and lawns.  Feeding perches adjacent to open
areas are essential; rolling terrain is preferred over completely flat
areas.  A dependable fruit supply is also important, particularly in
early spring when insect availability is low [41].  In the northern
sections of eastern bluebird range, key nesting habitat discriminators
in order of importance include topographic relief, presence of evergreen
shrubs, number of genera of deciduous trees, distance to nearest edge,
and slope.  In the central sections, key discriminators were topographic
relief, presence of evergreen shrubs, number of genera of deciduous
shrubs, relative eastern bluebird densities, and number of genera of
deciduous trees.  Nest box placement recommendations in relation to key
habitat parameters for the northern sections of eastern bluebird range
include presence of evergreen shrubs within a 100-foot (30 m) radius of
the box and presence of 5 to 13 genera of deciduous trees within a
100-foot (30 m) radius.  Distance to the nearest edge should be between
86 and 452 feet (26-137 m) and slope should be between 0 and 8 percent.
For the central sections it is recommended that there be no evergreen
shrubs in a 100-foot (30 m) radius, none or only one genus of deciduous
shrubs, and zero to four genera of deciduous trees within a 100-foot (30
m) radius [39].

Pinkowski [41] stated that dry, sandy, acid soil deficient in lime and
organic matter creates near-optimum conditions for eastern bluebirds.
In the Appalachian Mountains of western Virginia, eastern bluebirds were
more common in areas of dense, low vegetation with scattered residual
pole-sized trees and areas with open overstories and brushy
understories.  Nests were in snags in recent clearcuts [11].  Conner and
Adkinson [9] reported that eastern bluebirds prefer areas near
clearcuts.  In Virginia eastern bluebirds were observed in clearcuts
formerly occupied by oaks.  Nests were located in 1- to 2-year-old
clearcuts which were sparsely stocked with young hardwoods (oaks,
hickories [Carya spp.], black locust, sassafras [Sassafras albidum], and
flowering dogwood [Cornus florida]) about 3.3 feet (1 m) tall; in
5-year-old stands moderately stocked with 6.6-foot (2 m) tall hardwoods;
and one nest was located in a 12-year-old, densely stocked stand of 13-
to 16.5-foot (4-5 m) tall oaks and hickories. All nests were in standing
dead trees.  Eastern bluebirds were not present in 15-year-old stands
[8,9].

In Illinois eastern bluebird densities in sampled habitats were as
follows:  30 individuals per 100 acres (40 ha) in orchards, 34
individuals per 100 acres in edge communities with shrubs, 25
individuals per 100 acres in residential areas (lawns etc.), and 13
individuals per 100 acres in second-growth woods [25].

In central hardwood forests eastern bluebirds are common in regenerating
stands (seedling-shrub stage) but are not present in later successional
stages.  In loblolly-shortleaf pine (Pinus taeda-P. palustris) forests,
they are uncommon in regeneration and sapling stages and present in
old-growth stages but not present in pole and mature stands (possibly
because of the presence of snags) [17].

In the Southeast, red-cockaded woodpecker (Picoides borealis) holes are
used successively by other woodpeckers (Picidae), flycatchers (Empidonax
spp.), titmice (Parus spp.), and eastern bluebirds.  Squirrels and
chipmunks (Sciuridae) are also aggressive users of woodpecker holes
[15].  Pileated woodpeckers (Drycopus pileatus) sometimes make holes too
large to be used by some species, but eastern bluebirds use most of the
holes [5].

Winter habitats used by eastern bluebirds usually contain fruit-bearing
plants; these include open pine-oak woodlands, pastures (especially saw
palmetto (Serenoa repens)-pineland threeawn (Aristida stricta) in the
Southeast), open pine woodlands, and old fields [41].
  • 5. Beebe, Spencer B. 1979. Relationships between insectivorous hole-nesting birds and forest management. [Place of publication unknown]
  • 8. Conner, Richard N.; Adkisson, Curtis S. 1974. Eastern bluebirds nesting in clearcuts. Journal of Wildlife Management. 38(4): 934-935. [25042]
  • 9. Conner, Richard N.; Adkisson, Curtis S. 1975. Effects of clearcutting on the diversity of breeding birds. Journal of Forestry. 73: 781-785. [25043]
  • 11. Crawford, H. S.; Hooper, R. G.; Titterington, R. W. 1981. Songbird population response to silvicultural practices in central Appalachian hardwoods. Journal of Wildlife Management. 45(3): 680-692. [19282]
  • 15. Dennis, John V. 1971. Species using red-cockaded woodpecker holes in northeastern South Carolina. Journal of Ornithological Investigation. 42(2): 79-87. [26097]
  • 17. Dickson, James G.; Thompson, Frank R., III; Conner, Richard N.; Franzreb, Kathleen E. 1993. Effects of silviculture on neotropical migratory birds in central and southeastern oak pine forests. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1993 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 374-385. [24663]
  • 22. Goldman, Peter. 1975. Hunting behavior of eastern bluebirds. Auk. 92: 798-801. [25044]
  • 25. Graber, Richard R.; Graber, Jean W.; Kirk, Ethelyn L. 1971. Illinois birds: Turdidae. Biological Notes No. 75. Urbana, IL: Illinois Natural History Survey. 44 p. [25101]
  • 39. Emery, R. J. N.; Chinnappa, C. C. 1992. Natural hybridization between Stellaria longipes and Stellaria borealis (Caryophyllaceae). Canadian Journal of Botany. 70: 1717-1723. [20065]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 44. Pinkowski, Benedict C. 1977. Foraging behavior of the eastern bluebird. Wilson Bulletin. 89(3): 404-414. [25051]
  • 47. Pinkowski, Benedict C. 1979. Annual productivity and its measurement in a multi-brooded passerine, the eastern bluebird. Auk. 96: 562-572. [25053]
  • 55. Rustad, Orwin A. 1972. An eastern bluebird nesting study in south central Minnesota. Loon. 44: 80-84. [25097]
  • 58. Shugart, Herman Henry, Jr.; James, Douglas. 1973. Ecological succession of breeding bird populations in northwestern Arkansas. Auk. 90: 62-77. [25059]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the term: hardwood

   601  Bluestem prairie
   602  Bluestem-prairie sandreed
   603  Prairie sandreed-needlegrass
   604  Bluestem-grama prairie
   606  Wheatgrass-bluestem-needlegrass
   608  Wheatgrass-grama-needlegrass
   609  Wheatgrass-grama
   610  Wheatgrass
   611  Blue grama-buffalograss
   612  Sagebrush-grass
   708  Bluestem-dropseed
   709  Bluestem-grama
   710  Bluestem prairie
   711  Bluestem-sacahuista prairie
   717  Little bluestem-Indiangrass-Texas wintergrass
   720  Sand bluestem-little bluestem (dunes)
   721  Sand bluestem-little bluestem (plains)
   731  Cross timbers-Oklahoma
   732  Cross timbers-Texas (little bluestem-post oak)
   801  Savanna
   802  Missouri prairie
   804  Tall fescue
   809  Mixed hardwood and pine
   810  Longleaf pine-turkey oak hills
   811  South Florida flatwoods
   812  North Florida flatwoods

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

     1  Jack pine
    14  Northern pin oak
    15  Red pine
    20  White pine-northern red oak-red maple
    21  Eastern white pine
    40  Post oak-blackjack oak
    42  Bur oak
    43  Bear oak
    44  Chestnut oak
    45  Pitch pine
    46  Eastern redcedar
    50  Black locust
    51  White pine-chestnut oak
    52  White oak-black oak-northern red oak
    53  White oak
    55  Northern red oak
    64  Sassafras-persimmon
    67  Mohrs (shin) oak
    70  Longleaf pine
    71  Longleaf pine-scrub oak
    72  Southern scrub oak
    74  Cabbage palmetto
    75  Shortleaf pine
    76  Shortleaf pine-oak
    78  Virginia pine-oak
    79  Virginia pine
    80  Loblolly pine-shortleaf pine
    81  Loblolly pine
    82  Loblolly pine-hardwood
    83  Longleaf pine-slash pine
    84  Slash pine
    85  Slash pine-hardwood
   109  Hawthorn
   110  Black oak
   111  South Florida slash pine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES39 Prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K070  Sandsage-bluestem prairie
   K074  Bluestem prairie
   K075  Nebraska Sandhills prairie
   K076  Blackland prairie
   K077  Bluestem-sacahuista prairie
   K081  Oak savanna
   K082  Mosaic of K074 and K100
   K083  Cedar glades
   K084  Cross Timbers
   K088  Fayette prairie
   K089  Black Belt
   K095  Great Lakes pine forest
   K100  Oak-hickory forest
   K104  Appalachian oak forest
   K110  Northeastern oak-pine forest
   K111  Oak-hickory-pine forest
   K112  Southern mixed forest
   K116  Subtropical pine forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in the northern U.S. and Canada move south for winter. Northward migrants arrive in northern breeding areas mostly in March-April, sometimes late February. Southward migration is mainly September-November.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eastern bluebirds eat a variety of foods depending on the season. In summer months, eastern bluebirds consume mostly beetles (order Coleoptera), crickets, caterpillars, grasshoppers, and other insects. A United States Biological Survey study of 855 eastern bluebirds found that the bluebird diet was 68% insects. During the fall and winter seasons, when insects are less common, eastern bluebirds eat fruits and plants, including blackberries, honeysuckle, dogwood, red cedar, and wild grapes.

Eastern bluebirds drink water from ponds, streams and birdbaths. They appear to prefer running water versus standing water.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly insects, also other invertebrates and small fruits; often flies from low perch to ground to feed on Orthoptera and beetles (Terres 1980); also gleans from foliage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Eastern bluebirds eat a variety of foods depending on the season. In summer months, eastern bluebirds consume mostly beetles (order Coleoptera), crickets, caterpillars, grasshoppers, and other insects. A United States Biological Survey study of 855 eastern bluebirds found that the bluebird diet was 68% insects. During the fall and winter seasons, when insects are less common, eastern bluebirds eat fruits and plants, including blackberries, honeysuckle, dogwood, red cedar, and wild grapes.

Eastern bluebirds drink water from ponds, streams and birdbaths. They appear to prefer running water versus standing water.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

A large proportion of the eastern bluebird diet consists of arthropods,
most frequently grasshoppers and crickets, but also butterflies and
moths, spiders, and beetles [46].  Preferences of captive eastern
bluebirds included (in order) mealworms, crickets, grasshoppers, leaf
hoppers, locusts, sow bugs, and stink bugs.  Wild eastern bluebirds also
consume earthworms, May beetles, and caterpillars [41].  In Tennessee
eastern bluebirds continue to hunt for arthropods in winter; even on
cold days some arthropods, especially spiders, may be active on
south-facing slopes. When air and soil temperatures are below 32 degrees
Fahrenheit (0 deg C), insect activity (and therefore availability) is
extremely limited [52].  In northwestern Tennessee droppings collected
from nest boxes used as roost sites on the coldest days in winter
contained only plant materials.  Insects are inactive on these very cold
days [51,52].

Eastern bluebirds rely heavily on fruit in nonbreeding seasons when it
is available.  Fruit is usually scarce in the early part of the breeding
season.  In southern Michigan staghorn sumac and smooth sumac (Rhus
glabra) fruits are frequently consumed [44,46].  Fruits of chokecherry,
black cherry, multiflora rose, and flameleaf sumac (R. coppalina) are
also common dietary components [41].  In northwestern Tennessee in
winter, eastern bluebirds consume the fruit of sumacs (Rhus spp.),
flowering dogwood, grapes (Vitis spp.), Japanese honeysuckle (Lonicera
japonica), hackberry (Celtis spp.), rose (Rosa spp.), deciduous holly
(Ilex decidua), pokeweed (Phytolacca americana), greenbriers (Smilax
spp.), and climbing bittersweet (Celastrus scandens) [52].  In Florida
fruits eaten in the nonbreeding seasons include those of greenbriers,
smooth sumac, and juneberry (Amelanchier spp.).  Earthworms and
caterpillars are also consumed when available [41].

Nestlings are fed caterpillars, grasshoppers and crickets, spiders, and
(usually for older nestlings and fledglings) succulent early-maturing
fruits such as mulberries (Morus spp.), raspberries (Rubus spp.),
dogwood (Cornus spp.) fruits, cherries (Prunus spp.), and honeysuckle
berries (Lonicera spp.) [46].

Foraging Techniques:  The most common foraging technique is dropping
from a perch to capture already-spotted prey on or near the ground.
Eastern bluebirds also forage by flycatching, foliage hovering, and
rarely, gleaning [22,41,42,44,46].
  • 22. Goldman, Peter. 1975. Hunting behavior of eastern bluebirds. Auk. 92: 798-801. [25044]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 42. Pinkowski, Benedict C. 1976. Use of tree cavities by nesting eastern bluebirds. Journal of Wildlife Management. 40(3): 556-563. [25050]
  • 44. Pinkowski, Benedict C. 1977. Foraging behavior of the eastern bluebird. Wilson Bulletin. 89(3): 404-414. [25051]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 51. Pitts, T. David. 1981. Eastern bluebird population fluctuations in Tennessee during 1970-1979. Migrant. 52(2): 29-37. [25055]
  • 52. Pitts, T. David; Conner, Mike; Crews, Steven; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eastern bluebirds influence the composition of insect communities through their predation on insects. They also host many species of parasites, including mites, lice and blowflies.

Eastern bluebirds affect communities of the insects they eat. They also provide habitat for many species of parasites, including mites, lice and blowflies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern chipmunks and flying squirrels prey on eastern bluebird eggs and nestlings. House sparrows, European starlings, American kestrels  black rat snakes, black racers, fire ants, domestic cats, black bears, and raccoons are predators of adults and chicks.

When approached by a predator, male eastern bluebirds make a song-like warning cry. If a male is not present, a female will begin to sing, hoping to attract a protective male back to the territory. Both males and females will also flick their wings and warble when predators are nearby.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Eastern bluebirds affect communities of the insects they eat. They also provide habitat for many species of parasites, including mites, lice and blowflies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Tamias striatus and Glaucomys volans prey on eastern bluebird eggs and nestlings. Passer domesticus, Sturnus vulgaris, Falco sparverius  Elaphe obsoleta, Coluber, Solenopsis invicta, Felis silvestris, Ursus americanus, and Procyon lotor are predators of adults and chicks.

When approached by a predator, male eastern bluebirds make a song-like warning cry. If a male is not present, a female will begin to sing, hoping to attract a protective male back to the territory. Both males and females will also flick their wings and warble when predators are nearby.

Known Predators:

  • eastern chipmunks (Tamias_striatus)
  • southern flying squirrels (Glaucomys_volans)
  • house sparrows (Passer_domesticus)
  • European starlings (Sturnus_vulgaris)
  • American kestrels (Falco_sparverius)
  • black rat snakes (Elaphe_obsoleta)
  • black racers (Coluber)
  • fire ants (Solenopsis_invicta)
  • domestic cats (Felis_silvestris)
  • American black bears (Ursus_americanus)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Most nest failures are due to predation and/or nest site competitors.
In southern Michigan 23 percent of nest box failures was due to house
wrens (Troglodytes aedon) puncturing eggs or removing them; 18.8 percent
was due to raccoons (Procyon lotor) or other mammals, and 14 percent to
weather [45].  In that study raccoons had to be controlled before
successful eastern bluebird nesting occurred [41].  Eastern bluebird
nestlings were killed and partially eaten by an eastern chipmunks
(Tamias striatus) [38].  Red squirrels (Tamiasciurus hudsonicus) kill
adult eastern bluebirds and rob eggs.  House sparrows (Passer
domesticus) kill adult eastern bluebirds in nest boxes in competition
for nest sites [41].
  • 38. Miller, Wayne. 1968. Predation of bluebirds by an eastern chipmunk. Blue Jay. 26: 145. [25562]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 45. Pinkowski, Benedict C. 1977. Breeding adaptations in the eastern bluebird. Condor. 79: 289-302. [25052]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: fresh, natural, prescribed fire, shrubs, understory fire

The eastern bluebird is known as a fire-follower [1,16,35,62]; the low
sparse vegetation on fresh burns and plentiful natural cavities caused
by decay in fire injured or killed trees are important for eastern
bluebird habitat [36,41].  In southern pine forests, fire retards
succession, reduces midstory hardwoods and shrubs, and favors herbaceous
vegetation; all of these effects enhance eastern bluebird habitat [16].

An important consideration is the effect of fire on food sources.  Fire
often reduces understory fruit production [33].  There are conflicting
reports on the effect of fire on arthropod populations [16].  The
effects of fire on invertebrate populations may be transitory or long
lasting.  There is usually an immediate decrease in invertebrates due to
direct mortality and indirectly due to loss of food supplies and
shelter.  In some instances flying insects are attracted by heat, smoke,
or killed or damaged trees, and therefore populations of some species may
increase during and after a fire.  Fires reduce the populations of most
soil fauna (animals that spend most of their time on the forest floor or
mineral soils).  The length of time of this effect varies with fire
severity and postfire vegetation [36].

The Research Project Summary Effects of understory fire on cavity-nesting
birds in Arizona pine forests
provides information on prescribed fire effects
in Arizona pine (Pinus ponderosa var. arizonica) forest where eastern
bluebird was present.
  • 1. Ahlgren, I. F.; Ahlgren, C. E. 1960. Ecological effects of forest fires. Botanical Review. 26: 458-533. [205]
  • 16. Dickson, James G. 1981. Effects of forest burning on songbirds. In: Wood, Gene W., ed. Prescribed fire and wildlife in southern forests: Proceedings of a symposium; 1981 April 6-8; Myrtle Beach, SC. Georgetown, SC: Clemson University, Belle W. Baruch Forest Science Institute: 67-72. [14811]
  • 33. Lay, Daniel W. 1956. Effects of prescribed burning on forage and mast production in southern pine forests. Journal of Forestry. 54: 582-584. [13828]
  • 35. Lloyd, Hoyes. 1938. Forest fire and wildlife. Journal of Forestry. 36: 1051-1054. [16842]
  • 36. Lyon, L. Jack; Crawford, Hewlette S.; Czuhai, Eugene; [and others]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 62. Stoddard, Herbert L., Sr. 1963. Bird habitat and fire. In: Proceedings, 2nd annual Tall Timbers fire ecology conference; 1963 March 14-15; Tallahassee, FL. Tallahassee, FL: Tall Timbers Research Station: 163-175. [18997]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, polygyny, presence

The eastern bluebird is nonmigratory in many parts of its range.  This
trait confers an advantage over migratory competitors for limited nest
sites.  Eastern bluebirds and mountain bluebirds (Sialia currucoides)
may occupy the same nest site in different years [46].

Spring Migration and Territory Establishment:  Eastern bluebirds and
western bluebirds (Sialia mexicana) are similar in habitat requirements
and exhibit interspecific territoriality [37], as do eastern bluebirds
and mountain bluebirds in areas of sympatry.  Eastern bluebird territory
size varies seasonally.  In Michigan eastern bluebird territories are
largest in March and become progressively smaller through April, May,
and June [46].  Nonmigratory males establish territories from February
20 to March 10.  Other males arrive and establish territories from late
March to early April [48].  Females arrived after males in 1970, 1971,
and 1974 [46].  Krieg [29] however, reported that in northwestern New
York, the general pattern was a staggered arrival of male and female
birds from mid-March to early June.  Some birds arrived already paired,
others were unpaired [29].  In New York males choose territories in
mid-March [60].  Each territory is established around at least one nest
site and is usually expanded to include several potential nest sites
[29].  Territories may be established as long as 6 weeks or as little as
an hour before nest building occurs [71].  The males display and sing at
several nest sites to attract females.  After a female accepts a
particular site, she builds the nest out of dry grasses or other plant
materials; sometimes several nests are built in different sites before
eggs are laid in the final site [29,41].  Nest building usually takes 5
or 6 days, but may take 2 weeks or more; on occasion nests are built in
1 day or less and egg-laying commences immediately [71].  Eastern
bluebirds do not exhibit strong nest-site fidelity [48].

Eggs:  Egg laying normally starts soon after the nest completion, but
delays of more than a week are not unusual [71].  In southern Michigan
egg-laying activity begins in early April, with complete clutches
present as early as April 8.  Egg-laying activity (in a population)
usually peaks the third week of April and again the third week of June.
One egg is laid per day, usually with 1 or more days between eggs.  The
typical eastern bluebird clutch is three to five eggs, occasionally six
[41,71].  Incubation only begins after the clutch is complete [71].  The
female usually does all the incubation, and is either fed by the male or
takes short foraging trips [41,45].  Incubation lasts 13 to 15 days, and
ranges from 12 to 21 days [41].  In New York first broods usually hatch
at 14 days and later broods take 13 days, probably because of higher
temperatures [71].

Development of Young:  In New York first broods hatch in early May.  The
naked, altricial hatchlings are blind [60].  They are brooded almost
constantly by the female for the first few days; brooding becomes more
sporadic after feather growth commences, and ceases a few days before
the young leave the nest.  Brooding intensity varies with weather [71].
Both parents feed nestlings and remove fecal sacs [22,60].  Fledging
occurs from 15 to 20 days after hatching [41], most commonly at 17 or 18
days.  First flights are usually directly to a perch, and are 50 to 100
feet (15-30 m) in length.  Fledglings stay near the nest and each other,
roosting together at night.  Parents feed the fledglings, who begin to
find their own food about 2 weeks after fledging and achieve
independence 3 to 3.5 weeks after fledging.  Widowed females often
continue to raise the brood, often with help from unmated females and
immatures (often members of earlier broods).  Widowed males attempt to
raise broods if nestlings are well feathered; they also often have
helpers [71].

About 10 days after the first brood fledges, the female usually builds a
new nest (often in the same site) and lays a second clutch.  The male
continues to feed the young of the first brood; when the second brood
hatches the male and sometimes members of the first brood help feed the
nestlings [29,60].

Multiple Broods:  Eastern bluebirds often produce three broods in one
season in the central part of their range.  They are single-brooded on
the northern periphery, and usually double-brooded elsewhere [40].  In
southern Michigan there are two main nesting periods.  The spring
nesting period peaks from April 6 to May 14 and is fairly synchronized
(that is, most eastern bluebirds in the area are nesting at this time).
The summer nesting period occurs from June 7 to July 23.  Eastern
bluebirds nesting during the spring period usually attempt a second
brood in the summer period.  However, there is an intermediate period,
from May 15 to June 6.  Eastern bluebirds nesting in this period are
usually only able to raise a single brood [47].  Nesting success is
greatest in the intermediate period, but spring broods are bigger;
overall more fledglings are produced from spring broods [45]. 

Two or three broods in a season is typical for many populations of
eastern bluebirds; however, there are a number of reported instances of
the production of four clutches or broods.  A single pair of eastern
bluebirds produced four clutches in one season but only the first three
produced fledglings [32].  In Alabama a male eastern bluebird
successfully reared four broods in 1987.  This male apparently mated
with two different females, raising two broods with each female.  It is
possible that he was a helper rather than a parent with one of the
females; genetic relationships were undetermined [65].  In northeastern
Texas a single pair of eastern bluebirds (nonmigratory) successfully
raised four broods:  four eggs, one hatchling, one fledgling April 14;
five eggs, two hatchlings, two fledglings June 1; five eggs, one
hatchling, one fledgling July 12; and four eggs, four hatchlings, and
four fledglings August 22 [30].  Eastern bluebirds are predominantly
monogamous (one male and one female are the genetic parents of all
members of a brood) but polygyny has also been observed [23,24].

Fall Migration: The presence of fruit determines eastern bluebird
distribution in winter [41].  In winter eastern bluebirds are found
mainly in the southern half or two-thirds of the breeding range [71].
In southern Michigan probably close to 95 percent of eastern bluebirds
migrate southward; in some areas all of the eastern bluebirds migrate
[41,45].  The proportion of eastern bluebirds migrating decreases with
decreasing latitude [41].  Southward migration of eastern bluebird
flocks is usually leisurely as the birds search for food [71].  In New
York parents and both broods remain together in summer and fall, then
join larger flocks in the fall which move southward, stopping frequently
where food is plentiful.  New York State eastern bluebirds travel as far
south as Virginia and North Carolina [60].  In Tennessee eastern
bluebirds that are present during the breeding season are usually
nonmigratory.  They form small flocks of adults and immature birds in
late summer and stay together most of the nonbreeding season [52].

Nesting Success and Productivity:  Pinkowski [45] reported that eastern
bluebird achieved 56 percent nesting success in Michigan (nesting
success is defined as the proportion of nests producing at least one
fledgling).  Mean annual productivity for eastern bluebirds nesting in
southern Michigan, over a 10-year study, was five fledged young per pair
per season.  Estimated survival rates were 82 percent between fledging
and independence, 33 percent between independence and the start of the
next breeding season, and 50 percent thereafter (on an annual basis)
[47].  In west-central Wisconsin nest boxes placed on managed lands, 45
eastern bluebird nests produced an average of 1.2 fledged young per
nesting attempt [67].  Blowfly parasitism reduces nest productivity; it
is a serious problem in some areas [73].
  • 22. Goldman, Peter. 1975. Hunting behavior of eastern bluebirds. Auk. 92: 798-801. [25044]
  • 23. Gowaty, Patricia Adair. 1981. Aggression of breeding eastern bluebirds (Sialia sialis) toward their mates and models of intra- and interspecific intruders. Animal Behavior. 29: 1013-1027. [25099]
  • 24. Gowaty, Patricia Adair. 1983. Male parental care and apparent monogamy among eastern bluebirds (Sialia sialis). American Naturalist. 121: 149-157. [25045]
  • 29. Krieg, David C. 1971. The behavioral patterns of the eastern bluebird (Sialia sialis). Bulletin No. 415. Albany, NY: The University of the State of New York, The State Education Department, New York State Museum and Science Service. 139 p. [24779]
  • 30. Krueger, Harry. 1991. Verified fourth nesting by pair of eastern bluebirds. Sialia. 13(3): 91-92. [25047]
  • 32. Laskey, Amelia R. 1943. The nesting of bluebirds banded as nestlings. Bird-Banding. 14: 39-43. [25048]
  • 37. Marshall, Joe T., Jr. 1957. Birds of pine-oak woodland in southern Arizona and adjacent New Mexico. Pacific Coast Avifauna No. 32. Berkeley, CA: Cooper Ornithological Society. 125 p. [24995]
  • 40. Peakall, David B. 1970. The eastern bluebird: its breeding season, clutch size, and nesting success. Living Bird. 9: 239-255. [25049]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 45. Pinkowski, Benedict C. 1977. Breeding adaptations in the eastern bluebird. Condor. 79: 289-302. [25052]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 47. Pinkowski, Benedict C. 1979. Annual productivity and its measurement in a multi-brooded passerine, the eastern bluebird. Auk. 96: 562-572. [25053]
  • 48. Pinkowski, Benedict C. 1979. Nest site selection in eastern bluebirds. Condor. 81: 435-436. [25054]
  • 52. Pitts, T. David; Conner, Mike; Crews, Steven; [and others]
  • 60. Silverman, Beth G.; Krasny, Marianne E. 1989. Bluebirds in New York. 4-H Members' Guide. Ithaca, NY: Cornell Cooperative Extension Service. 21 p. [25115]
  • 65. Tucker, James W. 1990. Male eastern bluebird rears four broods during one season. Wilson Bulletin. 102(4): 726-728. [25060]
  • 67. Van Horn, Mia; Bacon, Bruce R. 1989. Eastern bluebird productivity and habitat preference on managed wildlife lands in west central Wisconsin. Passenger Pigeon. 51(3): 255-259. [25061]
  • 71. Zeleny, Lawrence. 1976. The bluebird: how you can help its fight for survival. Bloomington, IN: Indiana University Press. 170 p. [24786]
  • 73. Pinkowski, Benedict C. 1977. Blowfly parasitism of eastern bluebirds in natural and artificial nest sites. Journal of Wildlife Management. 41(2): 272-276. [25064]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eastern bluebirds communicate primarily through sounds. One of the most distinguishing characteristics of this species, aside from its distinctive coloring, is its song. Bluebirds have different songs for mating, territoriality, and other purposes. When heard, the most common call of the bluebird sounds like -chir wi- or -chur lee-. When repeated several times, the call resembles the words -truly- and -purity-. Eastern bluebirds also use visual cues to communicate.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Eastern bluebirds communicate mostly through sounds. They have different songs for mating, territoriality, and other purposes. The most common call of the bluebird sounds like -chir wi- or -chur lee-. When repeated several times, the call sounds like the words -truly- and -purity-. Eastern bluebirds also use body signals to communicate.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Eastern bluebirds can live up to 6 to 10 years. The oldest known wild individual lived 10 years and 5 months. However, most mortality occurs in the first year of life, making average lifespans much shorter than this.

Range lifespan

Status: wild:
10.4 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Eastern bluebirds can live up to 6 to 10 years. The oldest known wild individual lived 10 years and 5 months. However, most mortality occurs in the first year of life, making average lifespans much shorter than this.

Range lifespan

Status: wild:
10.4 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.4 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eastern bluebirds are generally monogamous. However, some studies have shown that more than one female or male are involved in some broods, suggesting that monogamy is not always the rule in this species. Occasionally, juveniles of a first brood remain near the nest to help the parents raise a second brood. This behavior is uncommon among eastern bluebird. Juvenile helpers are much more common among western bluebirds.

Mating System: monogamous ; cooperative breeder

Mating occurs in the spring and summer months. A mature female will typically raise two broods each season. Nests are constructed in trees within abandoned woodpecker holes or other cavities that provide adequate protection (usually several feet above ground). Construction of the nest is done primarily by the female and takes approximately 10 days to complete. These nests are small, cup-like structures that are lined with grass, feathers, stems, and hairs. Each female lays 3 to 7 (average 4 to 5) light-blue or, rarely, white eggs. The female incubates the eggs, which hatch after 13 to 16 days. The young are altricial at hatching. Fledglings leave the nest 15 to 20 days after hatching. Several studies have revealed that some young will stay around the nest to help raise another brood.

Both parents cooperate in raising the young, which they feed a diet insects. Fledglings are grayish in color with a speckled breast. The blue color becomes much more prominent and the speckles on their breast disappear as they mature. Bluebirds may begin breeding the summer after they are hatched.

Breeding interval: A mature female typically raises two broods each season.

Breeding season: Eastern bluebirds breed in the spring and summer.

Range eggs per season: 3 to 7.

Range time to hatching: 13 to 16 days.

Range fledging age: 15 to 20 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 4.

The young are altricial, meaning they cannot care for themselves upon hatching. Both parents cooperate in raising the young. The female broods the chicks for up to 7 days after hatching. Both parents feed the chicks while they are in the nest and for about three weeks after they have left the nest. The chicks are fed mainly insects.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Tveten, J. 1993. Birds of Texas. Fredricksburg, TX: Shearer Publications.
  • Gowaty, P., J. Plissner. 1998. Eastern Bluebird (Sialis sialis). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 381. Philadelphia, PA: The Birds of North America, Inc.
  • North American Bluebird Society, 1999. "Fact Sheet: Getting Started with Bluebirds" (On-line). Accessed December 1, 1999 at http://www.nabluebirdsociety.org/start.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting period varies with location and may begin as early as late February in some areas and extends into late summer. Clutch size is usually 4-5. Individual females in most areas produce 2 broods/year, sometimes 3, very rarely 4. Incubation, mainly by the female, lasts 12-16 days. Young are tended by both parents, leave nest at 15-20 days. Male tends fledged young if female renests. Young of the first brood may help feed the second brood.

Males and females of nesting pairs of eastern bluebirds commonly engage in copulations with other eastern bluebirds. As a result, some nests contain nestlings with different fathers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds are usually monogamous (one male mates with one female). Occasionally, one male will mate with two females. Sometimes, young bluebirds from one brood will stay near the nest to help their parents raise a second brood. However, this is not very common. Helpers are much more common among Sialia mexicana.

Mating System: monogamous ; cooperative breeder

Eastern bluebirds mate in spring and summer. A mature female will typically raise two broods each season. Females do most of the nest building over about 10 days. The nests are cup-shaped, and lined with soft grass. They are built in abandoned woodpecker holes or other cavities that provide protection (usually several feet above ground). Each female lays 3 to 7 (on average 4 or 5) light-blue eggs. The female then incubates the eggs, which means that she sits on them to keep them warm until they hatch. The eggs hatch 13 to 16 days after being laid. The chicks are altricial (helpless) when they hatch. The female broods the chicks to keep them warm, and both parents feed them insects. The fledglings leave the nest 15 to 20 days after hatching. Several studies have shown that some young stay around the nest to help their parents care for a second clutch. Young bluebirds may begin mating when they are one year old.

Breeding interval: A mature female typically raises two broods each season.

Breeding season: Eastern bluebirds breed in the spring and summer.

Range eggs per season: 3 to 7.

Range time to hatching: 13 to 16 days.

Range fledging age: 15 to 20 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The young are altricial, meaning they cannot care for themselves upon hatching. Both parents cooperate in raising the young. The female broods the chicks for up to 7 days after hatching. Both parents feed the chicks while they are in the nest and for about three weeks after they have left the nest. The chicks are fed mainly insects.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Tveten, J. 1993. Birds of Texas. Fredricksburg, TX: Shearer Publications.
  • North American Bluebird Society, 1999. "Fact Sheet: Getting Started with Bluebirds" (On-line). Accessed December 1, 1999 at http://www.nabluebirdsociety.org/start.htm.
  • Gowaty, P., J. Plissner. 1998. Eastern Bluebird (Sialis_sialis). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 381. Philadelphia, PA: The Birds of North America, Inc.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feathers produce non-iridescent colors: eastern bluebirds
 

Feathers of eastern bluebirds produce non-iridescent colors using self-assembled, quasi-ordered nanostructures.

     
  "Some of the most vivid colors in the animal kingdom are created not by pigments, but by wavelength-selective scattering of light from nanostructures. Here we investigate quasi-ordered nanostructures of avian feather barbs which produce vivid non-iridescent colors. These β-keratin and air nanostructures are found in two basic morphologies: tortuous channels and amorphous packings of spheres. Each class of nanostructure is isotropic and has a pronounced characteristic length scale of variation in composition. These local structural correlations lead to strong backscattering over a narrow range of optical frequencies and little variation with angle of incidence. Such optical properties play important roles in social and sexual communication. To be effective, birds need to precisely control the development of these nanoscale structures, yet little is known about how they grow. We hypothesize that multiple lineages of birds have convergently evolved to exploit phase separation and kinetic arrest to self-assemble spongy color-producing nanostructures in feather barbs. Observed avian nanostructures are strikingly similar to those self-assembled during the phase separation of fluid mixtures; the channel and sphere morphologies are characteristic of phase separation by spinodal decomposition and nucleation and growth, respectively. These unstable structures are locked-in by the kinetic arrest of the β-keratin matrix, likely through the entanglement or cross-linking of supermolecular β-keratin fibers. Using the power of self-assembly, birds can robustly realize a diverse range of nanoscopic morphologies with relatively small physical and chemical changes during feather development." (Dufresne et al. 2009:1792)
  Learn more about this functional adaptation.
  • Dufresne ER; Noh H; Saranathan V; Mochrie SGJ; Cao H; Prum RO. 2009. Self-assembly of amorphous biophotonic nanostructures by phase separation. Soft Matter. 5: 1792-1795.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sialia sialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAACCGGTGATTATTCTCAACCAACCACAAAGACATTGGCACTCTCTACCTAATCTTTGGTGCATGAGCCGGCATAGTCGGCACCGCCCTAAGTATTCTCATCCGAGCCGAATTAGGACAACCCGGTGCCCTTCTAGGCGATGACCAAGTGTACAATGTAATTGTTACCGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGATTAGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTTCTTCCCCCCTCCTTCCTCCTACTACTCGCTTCCTCCACAGTAGAAGCTGGAGTCGGAACAGGCTGAACTGTCTACCCACCCCTCGCTGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTTGCCATCTTTTCCCTTCACCTAGCAGGGATCTCTTCAATCCTAGGGGCTATCAACTTCATTACCACAGCAATCAACATGAAACCCCCTGCCCTTTCACAATACCAAACCCCCCTATTCGTCTGATCAGTACTAATCACTGCTGTCCTACTCCTCCTCTCTCTACCCGTTCTAGCCGCTGGCATCACTATGCTCCTCACCGACCGCAACCTAAACACAACCTTCTTCGACCCCGCAGGAGGAGGGGACCCTGTACTCTACCAACACCTGTTCTGATTCTTTGGCCACCCCGAAGTGTACATCCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sialia sialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

The future of eastern bluebirds has been of concern to conservation agencies. Population numbers have dropped drastically in the last few decades (in some places by as much as 90%), although recent increases in numbers have been encouraging. As a result, eastern bluebirds have been given some level of protection throughout their range. Two major hypotheses have been proposed to explain the decline, they are habitat destruction and competition. Much of the eastern bluebird's habitat has been turned into farmland or commercial property, greatly reducing food and shelter resources. Eastern bluebirds also compete with the more aggressive, introduced species, house sparrows and European starlings, for food and nesting sites. The most effective measure implemented to protect eastern bluebirds has been the introduction of nest boxes placed in good nesting habitat for bluebirds. These boxes are relatively easy to make and maintain and have been quite successful in places where they have been established.

Eastern bluebirds are listed as a species of "least concern" by the IUCN. They are not protected under CITES or the U.S. Endangered Species Act. There are an estimated 10,000,000 eastern bluebirds in North and Central America.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B,N5N : N5B: Secure - Breeding, N5N: Secure - Nonbreeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

The future of eastern bluebirds has been of concern to conservation agencies. Populations of eastern bluebirds have shrunk over the last few decades (in some places by as much as 90%). However, populations have been growing recently.

Eastern bluebirds are somewhat protected throughout their range. Two reasons why bluebird populations have declined are habitat destruction and competition. Much of the eastern bluebird's habitat has been turned into farmland or commercial property. This has greatly reduced the food and shelter available to bluebirds. Eastern bluebirds also have to compete with the more aggressive, introduced species, house sparrows and European starlings, for food and nesting sites.

The most effective measure that has been implemented to protect eastern bluebirds has been the introduction of nest boxes in good nesting habitat. These boxes are relatively easy to make and maintain. They have been quite successful in providing nesting places for eastern bluebirds.

Eastern bluebirds are listed as a species of "least concern" by the IUCN. They are not protected under CITES or the U.S. Endangered Species Act. There are about 10,000,000 eastern bluebirds in North and Central America.

IUCN Red List of Threatened Species: least concern

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

More info for the term: natural

Atwood [4] compiled state status lists of western landbirds; eastern
bluebird was listed as of special concern in Montana and a "watch"
species in North Dakota. Eastern bluebird was on the Audubon Society's
Blue List (1986) in 1972, from 1978 to 1982, and of Special Concern in
1986 [74]. In a 1979 compilation of state lists eastern bluebird was
listed as rare and/or endangered in Connecticut (1976), existing in
limited numbers in Massachusetts, and uncommon and declining in New
Hampshire [75]. It was listed in the South Dakota Natural Heritage
Database as a species monitored by the South Dakota Department of Game,
Fish, and Parks; apparently secure in the breeding season in South
Dakota, though rare statewide and with cause for long-term concern. It
was rated globally secure though rare in parts of its range [76].

In Canada, the eastern bluebird is listed as vulnerable in Manitoba, New
Brunswick, Nova Scotia, Ontario, Quebec, and Saskatchewan [77].
  • 4. Atwood, Jonathan L. 1994. Endangered small landbirds of the western United States. In: Jehl, Joseph R., Jr.; Johnson, Ned K., eds. A century of avifaunal change in western North America; Proceedings of an international symposium at the centennial meeting of the Cooper Ornithological Society; 1993 April 17; Sacramento, CA. Studies in Avian Biology No. 15. [Place of publication unknown]
  • 74. Tate, James, Jr. 1986. The Blue List for 1986. American Birds. 40(2): 227-235. [24324]
  • 75. Meridith, Denise P. 1979. Eastern States endangered wildlife. Alexandria, VA: U.S. Department of the Interior, Bureau of Land Management, Eastern States Office. 153 p. [24550]
  • 76. Houtcooper, Wayne C.; Ode, David J.; Pearson, John A.; Vandel, George M., III. 1985. Rare animals and plants of South Dakota. Prairie Naturalist. 17(3): 143-165. [1198]
  • 77. Committee on the Status of Endangered Wildlife in Canada. 1992. Canadian species at risk. Ottawa, ON. 10 p. [26183]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Increasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Comments: Threatened by nest-site competiton with starling and house sparrow, though this has been alleviated by provision of suitable nest boxes.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Management Requirements: See Peterson (1987), McComb et al. (1987), Mitchell (1988), and Parren (1991) for recent nest box designs and placement recommendations. See Lumsden (1989) for nest box preferences in Ontario. See also Scriven (date?), Bluebirds of the upper Midwest, a guide to successful trail management, Audubon Chapter of Minneapolis, 200 pp.

In Kentucky, Davis et al. (1994) found that bluebirds overwhelmingly preferred nest boxes containing old nests over empty boxes, suggesting that cleaning out nest boxes each year may not be a good idea. The authors speculated that the risk of blowfly parasitism may be reduced in boxes containing old nests because blowflies in those sites may be more likely to be victimized by a parasitic wasp. More research is needed. In South Carolina, Plissner and Gowaty (1995, Wilson Bulletin 107:289-295) found that sites with two nesting boxes were more attractive than those with only one nesting box.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management Considerations

More info for the terms: association, competition, natural, presence, selection, short-term effects, snag, tree

Historical Populations and Range Expansion:  There has been speculation
the genus Sialia evolved in the mountains of the southwestern United
States; the eastern bluebird was probably abundant in the sparse
pine-oak woods of Mexico and the southern states prior to European
settlement.  Native American burning practices probably created areas
suitable for eastern bluebirds [41].  From the early 1600's to about
1957 eastern bluebirds probably increased in eastern North America due
to increased amounts of edge and oldfield habitats from human activity.
Logging and slash burning create or enhance eastern bluebird habitat in
many areas.  In the 1900's the range of eastern bluebird expanded into
the Great Plains and more recently into the southwestern United States,
possibly as a response to logging [70].

Population Status and Trends:  In the late 1950's and early 1960's
eastern bluebirds declined to 17 percent of their previous numbers.
Eastern bluebird numbers were reported as very low in Pennsylvania where
they were formerly abundant [34].  James [20] referred to eastern
bluebirds as a "disaster species" after the severe winter of 1961.  An
unpublished 1964 American Ornithologists' Union report stated that the
eastern bluebird was thriving in the wilder northern parts of its range
but had suffered severely in more developed areas [69].  An analysis of
Breeding Bird Survey (BBS) data for the years 1965 to 1979 indicated
that eastern bluebirds declined significantly in the eastern and central
regions.  Declines and increases varied by subregions, showing a decline
when averaged over the entire continent [54].  Recoveries following
declines in 1976 and 1977 were documented [56].  During the period 1978
to 1987, BBS data indicated significant increases over much of the
eastern united States, with nonsignificant decreases in the lower
Mississippi Valley.

Trends for the entire period 1966 to 1987 are a mosaic of nonsignificant
increases and decreases:  the southern United States had nonsignificant
increases in populations of eastern bluebirds; more northerly regions
had significant declines; and seven states showed significant increases.
The authors pointed out that for bluebirds, selection of the interval
from which trends are estimated can greatly affect perceptions of the
trend.  Survey data can be greatly influenced by short-term effects, and
population trends estimated from variable populations contain an
environmentally induced "noise" component that is sometimes larger than
the long-term trend [56].  Currently eastern bluebirds are uncommon to
rare in the Northeast [14] but are either year-round residents or
short-distance migrants.  However, eastern bluebirds have recently
experienced a statistically significant increase in the region [61].
 
Causes of Declines:  Factors influencing eastern bluebird populations
include nest site availability, predators, diseases, parasites,
pesticides, and land use patterns [51].  James [20] analyzed Audubon
Society Christmas Bird Count data and concluded that there had been
long-term declines in wintering eastern bluebird populations from the
mid-1940's to 1961 and that there was a strong correlation between cold
winters and eastern bluebird declines.  The decline in eastern bluebird
numbers in the 1950's and 1960's was attributed to severe winters (a
late spring freeze in southern Michigan killed large numbers of eastern
bluebirds in 1958), use of heptachlor to control Argentine fire ants,
and to other biocidal agents [20,41,51].  There is no evidence that any
of these factors changed in the 1970's with the possible exception of
land use patterns.  Conversion of pasture into soybean production
reduced the amount of suitable eastern bluebird habitat [51].  Extreme
local declines [46] and extreme regional declines [51] have been noted
in association with severe weather during 1976 and 1977.

Low nesting success (including nest losses) has been attributed to
competition with European starlings (Sturnus vulgaris), house wrens, and
house sparrows, particularly where natural cavities are scarce.  Further
losses are caused by blowfly parasitism and loss of nest sites
[41,71,72].

Habitat Suitability and Nest Site Availability:  Many agricultural areas
formerly occupied by eastern bluebirds are now suboptimal for eastern
bluebirds because of a lack of nest sites [8].  In the southeastern
United States, a common cause of tree death is lightning.  Lightning
damaged or killed trees are quickly infested with beetles and other
insects.  Many species of birds, including eastern bluebird, are
attracted to these trees [28].  In open areas, particularly in
residential developments, humans usually remove dead limbs and trees.
Wooden fenceposts, once an abundant source of nest cavities for eastern
bluebirds, have largely been replaced by metal posts [26].

Competition for Nest Sites:  A number of authors report that the
availability of suitable nest or perch sites is the factor immediately
limiting to populations of hole-nesting birds, including eastern
bluebirds [5].  Niche overlap between eastern bluebirds and house
sparrows in south-central Oklahoma was greater than would be expected by
chance.  House sparrows have the potential to greatly influence the
nesting success of eastern bluebirds [53].  Competition for nest sites
has forced eastern bluebirds away from centers of human activity where
house sparrows and European starlings are relatively abundant [8].
House sparrows were able to usurp seven out of nine nest boxes occupied
by eastern bluebirds in a south-central Oklahoma study; they are
sometimes able to kill the eastern bluebird occupant of a desired nest
box [53]. 

The introduction of the European starling has greatly increased
competition for natural cavities with large holes.  The aggressive and
abundant European starling restricts eastern bluebirds to nest sites
with small holes [41,72], especially where peak use of nest sites by
European starlings coincides with the period in which eastern bluebirds
are establishing territories and choosing nest sites.  In Maryland an
investigation of competition between European starlings and eastern
bluebirds was conducted in a residential area using a nest box with a
large entrance hole.  This box was placed in an area containing nest
boxes with small holes, many of which were used by eastern bluebirds.
European starlings were so abundant in the area that they were probably
saturating all suitable nest sites.  Trapping and killing of European
starlings at the test box over the course of 3 years (a total of 335
European starlings) has reduced the numbers of European starlings seen
at the box, and it is hoped by the author that in a few more years
European starling populations may become low enough to reduce
competition with eastern bluebirds for large-hole cavities [72].  In
Kentucky, a study of 45 nest boxes over 3 nesting seasons evaluated
eastern bluebird productivity in the presence of European starlings.
Eastern bluebirds fledged almost as many young in 1983 when European
starlings used 60 percent of the boxes as in 1985 when European
starlings were excluded.  This result was attributed to the difference
in timing of nest box use.  European starlings produced one brood in the
nest box and eastern bluebirds produced broods both before and after
European starling use each year.  No eastern bluebird nests were taken
over or destroyed by European starlings in this study; it was therefore
concluded that European starlings had little impact on eastern bluebird
nesting success [12].

Other competitors of eastern bluebird include mountain and western
bluebirds in areas of sympatry, particularly in the Great Plains
grasslands where eastern and mountain bluebirds have expanded their
ranges [46].

Nest Box Programs:  Nest box programs have become popular in many areas
[41].  Pinkowski [45] reported that the nesting success rate (proportion
of nests that produce at least one fledgling) was similar in natural
cavities and in nest boxes.  Recommended dimensions for nest boxes are
available [26,60,72,73].  Blowfly parasitism rates are similar in
natural cavities and in next boxes, but nest boxes often have a higher
number of blowflies per nest [73].  Nest boxes are most effective in
open areas.  In south-central Oklahoma eastern bluebirds chose nest
boxes in open areas with few trees [53].

Environmental Toxins:  In Wisconsin treatment of eastern bluebird
nesting areas with paper mill sludge containing dioxin had no measurable
adverse effects on growth or reproduction of eastern bluebirds as
compared to untreated plots.  Eggs collected from treated study plots
had dioxin levels ranging from 6.6 to 11 picograms per gram of egg
(1 ppt).  Eastern bluebird eggs injected with 1,000 ppt of dioxin
exhibited no toxic effects (i.e., eggs hatched at the normal rate), but
eggs injected with 10,000 ppt did not hatch [63].

Management Recommendations:  In South Carolina pine and pine-hardwoods,
10 snags per 100 acres (40 ha) is optimal for maintaining eastern
bluebird populations at 3.2 pairs per 100 acres (40 ha).  However,
maintenance of all cavity-nesting species present at their average
population levels would require 311 snags per 100 acres.  The principal
cause of tree death and snag production in this area is lightning;
currently these trees are rapidly removed for firewood.  The authors
recommend severely limiting the removal of lightning- and insect-killed
trees in order to provide more snags for wildlife use.  Other
recommendations include retention of snags in clearcuts, leaving large
snags instead of small ones, and protection of drainage systems by
leaving strips of unmanaged forest along creeks to provide cavity trees
[27].  Clearcuts in oak-hickory forest can be good nesting areas for
eastern bluebirds provided that snags are present [26].
  • 14. DeGraaf, Richard M.; Scott, Virgil E.; Hamre, R. H.; [and others]
  • 5. Beebe, Spencer B. 1979. Relationships between insectivorous hole-nesting birds and forest management. [Place of publication unknown]
  • 8. Conner, Richard N.; Adkisson, Curtis S. 1974. Eastern bluebirds nesting in clearcuts. Journal of Wildlife Management. 38(4): 934-935. [25042]
  • 12. Davis, Wayne H.; McComb, William C.; Allaire, Pierre N. 1986. Nest box use by starlings: does it inhibit bluebird production?. Transactions of the Kentucky Academy of Science. 47(3-4): 133-136. [25100]
  • 20. James, Douglas. 1962. Winter 1961-62: dominated by movements of boreal birds and marked by still low numbers of eastern bluebirds. Audubon Field Notes. 16: 306-311. [25046]
  • 26. Hardin, Kimberly I.; Evans, Keith E. 1977. Cavity nesting bird habitat in the oak-hickory forests--a review. Gen. Tech. Rep. NC-30. St. Paul, MN: U.S. Department of Agriculture, Forest Service, North Central Forest Experiment Station. 23 p. [24053]
  • 27. Harlow, Richard F.; Guynn, David C., Jr. 1983. Snag densities in managed stands of the South Carolina coastal plain. Southern Journal of Applied Forestry. 7(4): 224-229. [12571]
  • 28. Komarek, E. V. 1974. Introduction to lightning ecology. In: Proceedings, annual Tall Timbers fire ecology conference; 1973 March 22-23; Tallahassee, FL. No. 13. Tallahassee, FL: Tall Timbers Research Station: 421-427. [19014]
  • 34. Leberman, Robert C. 1961. Nesting boxes and bluebirds. EBBA News. [Eastern Blue Bird Association]
  • 41. Pinkowski, Benedict C. 1974. A comparative study of the behavioral and breeding ecology of the eastern bluebird (Sialia sialis). Detroit, MI: Wayne State University. 470 p. Dissertation. [25082]
  • 45. Pinkowski, Benedict C. 1977. Breeding adaptations in the eastern bluebird. Condor. 79: 289-302. [25052]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 51. Pitts, T. David. 1981. Eastern bluebird population fluctuations in Tennessee during 1970-1979. Migrant. 52(2): 29-37. [25055]
  • 53. Pogue, Darrell W.; Schnell, Gary D. 1994. Habitat characterization of secondary cavity-nesting birds in Oklahoma. Wilson Bulletin. 106(2): 203-226. [25057]
  • 54. Robbins, Chandler S.; Bystrak, Danny; Geissler, Paul H. 1986. The breeding bird survey: its first fifteen years, 1965-1979. Resource Publication 157. Washington, DC: U.S. Department of the Interior, Fish and Wildlife Service. 196 p. [24549]
  • 56. Sauer, John R.; Droege, Sam. 1990. Recent population trends of the eastern bluebird. Wilson Bulletin. 102(2): 239-252. [25058]
  • 60. Silverman, Beth G.; Krasny, Marianne E. 1989. Bluebirds in New York. 4-H Members' Guide. Ithaca, NY: Cornell Cooperative Extension Service. 21 p. [25115]
  • 61. Smith, Charles R.; Pence, Diane M.; O'Connor, Raymond J. 1993. Status of neotropical migratory birds in the Northeast: a preliminary assessment. In: Finch, Deborah M.; Stangel, Peter W., eds. Status and management of neotropical migratory birds: Proceedings; 1992 September 21-25; Estes Park, CO. Gen. Tech. Rep. RM-229. Fort Collins, CO: U.S. Department of Agriculture, Forest Service, Rocky Mountain Forest and Range Experiment Station: 172-188. [17614]
  • 63. Thiel, David A.; Martin, Stephen G.; Duncan, James W.; [and others]
  • 69. Wallace, George J. 1964. Michigan bird survey, spring, 1964. Jack-Pine Warbler. 43(1): 26-38. [25098]
  • 70. Witzeman, Janet; Hubbard, John P.; Kaufman, Kenn. 1976. Southwest region. American Birds. 30(5): 985-990. [25062]
  • 71. Zeleny, Lawrence. 1976. The bluebird: how you can help its fight for survival. Bloomington, IN: Indiana University Press. 170 p. [24786]
  • 72. Zerhusen, Peter A. 1992. European starling--eastern bluebird nest site competition, IV. Sialia. 14(2): 55-58, 72. [25063]
  • 73. Pinkowski, Benedict C. 1977. Blowfly parasitism of eastern bluebirds in natural and artificial nest sites. Journal of Wildlife Management. 41(2): 272-276. [25064]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Use of Fire in Population Management

More info for the terms: natural, prescribed fire, shrubs

Savannas and open stands are natural bluebird habitat that usually
require recurrent fire for maintenance.  Prescribed fire is usually
beneficial to eastern bluebirds, especially if it controls shrubs and
understory hardwoods [46].
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

There are no known adverse affects of eastern bluebirds on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds may help to control insect populations.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Negative

We do not know of any way that eastern bluebirds harm humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Economic Importance for Humans: Positive

Eastern bluebirds may help to control insect populations.

Positive Impacts: controls pest population

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Eastern bluebird

The eastern bluebird (Sialia sialis) is a small bird found in open woodlands, farmlands, and orchards. It is the state bird of Missouri[2] and New York.

This species measures 16–21 cm (6.3–8.3 in) long, spans 25–32 cm (9.8–12.6 in) across the wings, and weighs 27–34 g (0.95–1.20 oz).[3][4] Eastern bluebirds are found east of the Rockies, southern Canada to the Gulf states, and southeastern Arizona to Nicaragua.

The bright-blue breeding plumage of the male, easily observed on a wire or open perch, makes this species a favorite of birders. The male's call includes sometimes soft warbles of 'jeew' or 'chir-wi' or the melodious song 'chiti WEEW wewidoo'.[5] The oldest recorded eastern bluebird was 10 years and 5 months old.[6]

Food[edit]

About two-thirds of the diet of an adult consists of insects and other invertebrates. The remainder of the bird's diet is made up of wild fruits or berries Favored insect foods include grasshoppers, crickets, katydids, and beetles. Other food items include earthworms, spiders, millipedes, centipedes, sow bugs, and snails.

Male

Fruits are especially important when insects are scarce in the winter. Some preferred winter food sources include dogwood, hawthorn, wild grape, and sumac, and hackberry seeds. Supplemental fruits eaten include black raspberries, bayberries, fruit of honeysuckle, Virginia creeper, eastern juniper, and pokeberries. Bluebirds feed by perching on a high point, such as a branch or fence post, and swooping down to catch insects on or near the ground. The availability of a winter food source will often determine whether or not a bird will migrate. If bluebirds do remain in a region for the winter, they group and seek cover in heavy thickets, orchards, or other areas in which adequate food and cover resources are available.

Life history[edit]

Eastern bluebirds are very social birds. At times, they gather in flocks of a hundred or more. However, they are territorial during the breeding season and may continue to defend a feeding area throughout the winter. Mating occurs in the spring and summer. A mature female typically raises two broods each season. Nests are constructed in trees within abandoned woodpecker holes or other cavities that provide adequate protection (usually several feet above ground). Construction of the nest is done primarily by the female and takes around 10 days to complete. These nests are small, cup-like structures lined with grass, feathers, stems, and hairs. Each female lays three to seven light-blue or, rarely, white eggs. The female incubates the eggs, which hatch after 13 to 16 days. The young cannot care for themselves upon hatching. The female broods the chicks for up to seven days after hatching. Fledglings then leave the nest 15 to 20 days after hatching.[4]

Both parents cooperate in raising the young, which they feed a diet consisting almost entirely of insects. Some young stay around the nest to help raise another brood. Fledglings are grayish in color with speckled breasts. The blue color becomes much more prominent and the speckles on their breasts disappear as they mature. Bluebirds may begin breeding the summer after they are hatched.[4]

Eastern bluebirds can live for six to 10 years. The record lifespan for a bluebird was 10 years and five months. However, a majority of bluebirds die within their first year of life. Starvation and freezing can threaten young bluebirds, but most threats come from other animals, including humans. Natural predators of eggs and nestlings can include eastern chipmunks, flying squirrels, American black bears, fire ants, and raccoons. Bluebirds of all ages (including adults) are threatened by rat snakes, racers, and American kestrels. Introduced species such as European starlings, house sparrows and domestic cats pose a major threat to bluebird nests, as well, with the cat being a serious predator of adult bluebirds and the other birds being competitors for nesting sites. Non-nesting adults face predation with all native species of falcons, owls, and most varieties of hawks (particularly in the Accipiter genus). When approached by a predator, males make a song-like warning cry. If a male is not present, a female will begin to sing, hoping to attract a protective male back to the territory. Both males and females also flick their wings and warble when predators are nearby, but losses are often heavy when a persistent predator finds their nest.[4]

Habitat[edit]

Eastern bluebird eggs

Eastern bluebirds tend to live in open country around trees, but with little understory and sparse ground cover. Original habitats probably included open, frequently burned pine savannas, beaver ponds, mature but open woods, and forest openings. Today, they’re most common along pastures, agricultural fields, suburban parks, backyards, and even golf courses. This bird also occurs across eastern North America and south as far as Nicaragua. Birds that live farther north and in the west of the range tend to lay more eggs than eastern and southern birds.[6]

Similar species[edit]

References[edit]

  1. ^ BirdLife International (2012). "Sialia sialis". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ http://www.moga.mo.gov/statutes/chapters/chap010.htm
  3. ^ Eastern Bluebird, All about Birds
  4. ^ a b c d Sialia sialis, Animal Diversity
  5. ^ Sibley, D.A. (2000) The Sibley Guide to Birds. New York:Alfred A. Knopf. p.401.
  6. ^ a b "Eastern Bluebird, Life History". All about birds. The Cornell Lab of Ornithology. Retrieved 6 June 2014. 
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

The currently accepted scientific name for eastern bluebird is Sialia
sialis (Linnaeus) [3,59]. It is a member of the family Muscicapidae
[59].

Subspecies recognized in the American Ornithologist's Union 1957
checklist (the last edition including subspecies) include [2]:

S. s. sialis Linnnaeus, eastern bluebird
S. s. grata Bangs, Florida bluebird
S. s. episcopus Oberholser, Tamaulipas bluebird
S. s. fulva Brewster, azure bluebird

Eastern bluebird interbreed with mountain bluebird (S. currucoides) [46].
  • 2. American Ornithologists' Union. 1983. Checklist of North American birds. 6th ed. Lawrence, KS: Allen Press, Inc. 877 p. [21234]
  • 46. Pinkowski, Benedict C. 1979. Foraging ecology and habitat utilization in the genus Sialia. In: Dickson, James G.; Conner, Richard N.; Fleet, Robert R.; [and others]
  • 3. American Ornithologists' Union. 1957. Checklist of North American birds. 5th ed. Baltimore, MD: The Lord Baltimore Press, Inc. 691 p. [21235]
  • 59. Sibley, Charles G.; Monroe, Burt L., Jr. 1990. Distribution and taxonomy of the birds of the world. New Haven, CT: Yale University Press. 1111 p. [22814]

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Common Names

eastern bluebird

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!