Overview

Brief Summary

Sialia sialis

A small (7 inches) thrush, the male Eastern Bluebird is most easily identified by its deep blue head and back, red breast, and white belly. Female Eastern Bluebirds are similar to males, but are a duller gray-blue on the head and back. This species is unmistakable across much of its range, but Western Bluebirds (Sialia mexicana), which occur in southern Arizona and as vagrants on the western Great Plains, are of similar size and color. The Eastern Bluebird breeds across much of the eastern United States and southern Canada. In winter, northerly-breeding populations migrate to the southern U.S. and northern Mexico, while southerly-breeding populations are non-migratory. Other non-migratory populations exist in Mexico and Central America, one of which extends north into extreme southern Arizona. Eastern Bluebirds historically inhabited variety of open woodland habitats. In modern times, this species has expanded into human-altered environments such as orchards, shrubby agricultural fields, and large yards in suburban areas. Eastern Bluebirds primarily eat fruits, berries, and small invertebrates. In appropriate habitat, Eastern Bluebirds may be observed flying down to the ground from perches in pursuit of prey. In many areas during the breeding season, this species is most easily located by looking for pole-mounted nest boxes in open areas: wherever these nest boxes are found, there are likely Eastern Bluebirds around. This species is primarily active during the day.

Threat Status: Least Concern

  • Eastern Bluebird (Sialia sialis). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • Gowaty, Patricia Adair and Jonathan H. Plissner. 1998. Eastern Bluebird (Sialia sialis), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/381
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Sialia sialis. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • eBird Range Map - Eastern Bluebird. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

Global Range: Breeding range extends from southern Saskatchewan east across southern Canada to Nova Scotia, and south to Nicaragua, the North American Gulf Coast, southern Florida, and Bermuda, and west to the western Great Plains; also southeastern Arizona. Winter range extends from the middle portions of the eastern United States south through the breeding range and western Cuba.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 1 person

Average rating: 4.0 of 5

This species has a very broad range. It is found east of the Rocky Mountains, spanning from southern Canada to the Gulf states and on into Mexico and Honduras. There are also populations found in Cuba, although it is not a native species there.

Biogeographic Regions: nearctic (Native )

  • Terres, J. 1980. The Audubon Society: Encyclopedia of North American Birds. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 1 person

Average rating: 3.0 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Occurrence in North America


AL AK AZ AR CO CT DE FL GA IL
IN IA KS KY LA ME MD MA MI MN
MS MO MT NE NH NJ NY NC ND OH
OK PA RI SC SD TN TX UT VT VA
WV WI WY DC
MB NB NF NS ON PE PQ SK
MEXICO

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Geographic Range

Eastern Bluebirds are native to the Nearctic region. They are found east of the Rocky Mountains from southern Canada to the Gulf states and into Mexico and Honduras. Humans have introduced these bluebirds to Cuba.

Biogeographic Regions: nearctic (Native )

  • Terres, J. 1980. The Audubon Society: Encyclopedia of North American Birds. New York: Alfred A. Knopf.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds breed from southern Saskatchewan east to southern Nova
Scotia and south through the eastern United States [2].  In the West it
occurs casually along the eastern foothills of the Rocky Mountains in
Montana, Wyoming, and Colorado, more commonly in the Dakotas through
central Nebraska, central Kansas, and central Oklahoma to central and
southeastern Texas, and south to most of Mexico [41,70].  Eastern
bluebird was listed in 1969 as a species whose present occurrence in
Arizona is limited, unknown, or only suspected [64], although more
recent work [46] lists Arizona as within its range.

Eastern bluebirds winter in the middle parts of the United States south
to Nuevo Leon, the Gulf Coast, and southern Florida, and rarely to
western Cuba [2].

Ranges of subspecies are as follows:

Florida bluebird:  Resident throughout peninsular Florida

Tamaulipas bluebird:  Tamaulipas north to the Rio Grande valley in
south-central Texas 

Azure bluebird:  Transition zone from the mountains of southern Arizona
south to Jalisco, Oaxaca, and Vera Cruz (Guerrero).  Winters south to
northern Guatemala [2,6].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Regional Distribution in the Western United States

More info on this topic.

This species can be found in the following regions of the western United States (according to the Bureau of Land Management classification of Physiographic Regions of the western United States):

   13  Rocky Mountain Piedmont
   14  Great Plains
   15  Black Hills Uplift
   16  Upper Missouri Basin and Broken Lands

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Morphology

Eastern bluebirds are small birds with short, slender beaks and short legs. They are brightly colored, with a blue upper body, red breast, and white abdomen. Males have wing and tail feathers that are blue with black or gray shafts and tips. Their heads are a lighter shade of blue, which fades into a red throat and breast area. The breast and belly are white with light blue tips on some of the longer feathers. Females also exhibit this pattern of coloration, although they tend to be duller than males and have more gray. Adult weight ranges from 27 to 34 grams. They are, on average 18 cm long from the tip of their beak to the end of their tail.

Young bluebirds are grayish in color. They have speckled breasts and their wings are tipped in blue. The blue color becomes much more prominent and the speckles on their breast disappear as they become adults.

There are eight recognized subspecies of Sialia sialis. These subspecies are distinguished based on coloration and geographic range.

Range mass: 27 to 34 g.

Range length: 16 to 21 cm.

Average length: 18 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Eastern bluebirds are small birds with short, slender beaks and short legs. They are brightly colored, with a blue upper body, red breast, and white belly. Males have wing and tail feathers that are blue with black or gray shafts and tips. Females look similar to males, but are usually duller in color and are slightly larger.

Adult eastern bluebirds weigh 27 to 34 grams. They are about 18 cm long from the tip of their beak to the end of their tail.

Young bluebirds are grayish in color. They have speckled breasts and their wings have blue tips. As they become adults, the blue color becomes much more obvious, and speckles on their breast disappear.

Range mass: 27 to 34 g.

Range length: 16 to 21 cm.

Average length: 18 cm.

Other Physical Features: endothermic ; bilateral symmetry ; polymorphic

Sexual Dimorphism: female larger; sexes colored or patterned differently; male more colorful

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Size

Length: 18 cm

Weight: 32 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds prefer open land with scattered trees for perching, nesting, and feeding. They are often seen in parks, gardens, hedges, and other areas that provide perches. They are also commonly found sitting on fences and utility wires.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Habitat includes forest edge, open woodland, and partly open situations with scattered trees, from coniferous or deciduous forest to riparian woodland, also pine woodland or savanna in the tropics. Nests are in natural cavities, old woodpecker holes, bird boxes, or similar sites, mostly 3-20 feet (1-6 meters) above ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associated Plant Communities

More info for the term: low-severity fire

Eastern bluebirds are found in a wide range of plant communities with
open overstories and in openings within woodlands.  They are usually
found at low elevations and are frequently observed in oak (Quercus
spp.) woodlands [46].  In southern Michigan, oak-pine (Pinus spp.)
woodlands frequented by eastern bluebirds were dominated by black oak
(Quercus velutina), pin oak (Q. palustris), northern red oak (Q. rubra),
white oak (Q. alba), eastern white pine (Pinus strobus), red pine (P.
resinosa), jack pine (P. banksiana), and Scotch pine (P. sylvestris).
Eastern bluebirds are also commonly found in old fields characterized by
hawthorns (Crataegus spp.), black walnut (Juglans nigra), black locust
(Robinia pseudoacacia), black cherry (Prunus serotina), chokecherry (P.
virginiana), staghorn sumac (Rhus typhina), and multiflora rose (Rosa
multiflora) [46].  Other eastern bluebird sites include the jack pine
plains of Huron National Forest, dominated by jack pine, northern pin
oak (Quercus ellipsoidalis), and scarlet oak (Q. coccinea).  Bracken
fern (Pteridium aquilinum), blueberries (Vaccinium spp.), and sweet fern
(Comptonia peregrina) are characteristic understory components [41].
Eastern bluebirds are also present in cutover and burned pine-oak
woodlands [46] and in Wisconsin jack pine savanna.  The latter habitat
type is maintained by frequent low-severity fire [68].  Eastern
bluebirds are common in regenerating stands of central and southeastern
oak-pine forests [17].

In western Virginia eastern bluebirds were observed in the Appalachian
Mountains in lower and midslope forests dominated by scarlet oak, black
oak, chestnut oak (Q. prinus), and white oak [11].

Wintering areas used by eastern bluebirds in the Apalachicola National
Forest included pasture, open longleaf pine (Pinus palustris) woods, and
pine-oak woodlands usually dominated by live oak (Q. virginiana) with
Spanish moss (Tillandsia usneoides) [41].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds prefer open land with scattered trees for perching, nesting, and feeding. They are often seen in parks, gardens, hedges, and other areas that provide perches. They are also commonly found sitting on fences and utility wires.

Habitat Regions: temperate ; tropical ; terrestrial

Terrestrial Biomes: savanna or grassland

Other Habitat Features: suburban ; agricultural

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Cover Requirements

More info for the terms: cover, natural, tree

Nesting:  Eastern bluebirds nest in tree cavities, nest boxes, and
crevices.  Many nests are built in abandoned woodpecker (Picidae) holes,
knotholes, and cavities formed by decay and/or fire wounds.  Eastern
bluebirds rarely nest in open situations.  In southern Michigan eastern
bluebirds apparently prefer nest boxes to natural cavities but fidelity
to one type of nest site is not strong.  Nest boxes may be more
attractive than natural cavities because they are usually placed in
suitable locations and have optimal dimensions.  Most changes from one
type of nest site to another occur after nest failures [45,48].

Most natural cavities used by eastern bluebirds are in oaks or American
elm (Ulmus americana) stubs [45,48].  Fire-scarred snags are also
commonly used [42].  In South Carolina longleaf pine-loblolly pine
stands, optimal d.b.h. of snags for cavity trees is 8 inches (20 cm)
[27].  In oak-pine woodlands the average height of cavities in pine
snags used by eastern bluebirds was 12 feet (3.6 m) and ranged from 1.7
to 55 feet (0.5-16.8 m).  Cavity depth averaged 7.8 inches (19.8 cm) and
ranged from 3 to 19 inches (7.6-48.8 cm), entrance diameter averaged 2.4
inches (6.1 cm) and ranged from 1.5 to 5.2 inches (3.7-13.3 cm), and
interior diameter averaged 3.6 inches (9.2 cm) and ranged from 2.2 to
6.3 inches (5.7-15.9 cm).  Entrance hole orientation does not affect
nest site use, although there is a slight tendency to choose cavities
facing southwest [41,42].

Foraging:  Perches near open areas, with an unobstructed view of air and
ground and sparse ground cover, are favored foraging sites.  Dead
branches are preferred over live ones, presumably for greater prey
visibility.  Where natural vegetation is tall, eastern bluebirds prefer
mowed areas to unmowed areas.  Areas with dry, nonfertile soils, low
vegetation, and much bare ground are also favored [22,46].

Roosting:  Night roosting sites are commonly in pine, oak, or pine-oak
woodlands with fairly large trees [41].  In winter, eastern bluebirds
use nest boxes for roosting only on very cold days (in Tennessee they
roosted in nest boxes on days when the temperature was 14 degrees
Fahrenheit [-10 deg C] or lower).  Numbers of eastern bluebirds in nest
box roosts ranged from 1 to 16 [50,51].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Preferred Habitat

More info for the terms: forbs, hardwood, presence, shrubs, succession

Nesting and Foraging Habitat:  Eastern bluebirds usually forage near the
nest site.  In Ohio eastern bluebirds traveled up to 1,320 feet (400 m)
from the nest on foraging trips [22].  Eastern bluebirds generally
prefer early successional habitats or open stands.  In Arkansas several
plots representing various stages of oldfield succession were surveyed
for birds.  Eastern bluebirds were observed only in burned fields and in
woody fields and not in more heavily wooded plots [58].  Within the
oak-hickory (Carya spp.) forest, eastern bluebirds prefer to nest in
savanna and savanna-like habitats such as pastures with scattered small
trees and bushes, usually near a lake or other body of water [55].  In
southern Michigan eastern bluebirds forage in open terrain [47].  They
are most commonly found in old fields dominated by forbs and grasses
with scattered trees and shrubs [44], oak and pine woodlands, open woods
with brushy undergrowth, areas of tall weeds, roads and roadsides,
recently plowed ground, and lawns.  Feeding perches adjacent to open
areas are essential; rolling terrain is preferred over completely flat
areas.  A dependable fruit supply is also important, particularly in
early spring when insect availability is low [41].  In the northern
sections of eastern bluebird range, key nesting habitat discriminators
in order of importance include topographic relief, presence of evergreen
shrubs, number of genera of deciduous trees, distance to nearest edge,
and slope.  In the central sections, key discriminators were topographic
relief, presence of evergreen shrubs, number of genera of deciduous
shrubs, relative eastern bluebird densities, and number of genera of
deciduous trees.  Nest box placement recommendations in relation to key
habitat parameters for the northern sections of eastern bluebird range
include presence of evergreen shrubs within a 100-foot (30 m) radius of
the box and presence of 5 to 13 genera of deciduous trees within a
100-foot (30 m) radius.  Distance to the nearest edge should be between
86 and 452 feet (26-137 m) and slope should be between 0 and 8 percent.
For the central sections it is recommended that there be no evergreen
shrubs in a 100-foot (30 m) radius, none or only one genus of deciduous
shrubs, and zero to four genera of deciduous trees within a 100-foot (30
m) radius [39].

Pinkowski [41] stated that dry, sandy, acid soil deficient in lime and
organic matter creates near-optimum conditions for eastern bluebirds.
In the Appalachian Mountains of western Virginia, eastern bluebirds were
more common in areas of dense, low vegetation with scattered residual
pole-sized trees and areas with open overstories and brushy
understories.  Nests were in snags in recent clearcuts [11].  Conner and
Adkinson [9] reported that eastern bluebirds prefer areas near
clearcuts.  In Virginia eastern bluebirds were observed in clearcuts
formerly occupied by oaks.  Nests were located in 1- to 2-year-old
clearcuts which were sparsely stocked with young hardwoods (oaks,
hickories [Carya spp.], black locust, sassafras [Sassafras albidum], and
flowering dogwood [Cornus florida]) about 3.3 feet (1 m) tall; in
5-year-old stands moderately stocked with 6.6-foot (2 m) tall hardwoods;
and one nest was located in a 12-year-old, densely stocked stand of 13-
to 16.5-foot (4-5 m) tall oaks and hickories. All nests were in standing
dead trees.  Eastern bluebirds were not present in 15-year-old stands
[8,9].

In Illinois eastern bluebird densities in sampled habitats were as
follows:  30 individuals per 100 acres (40 ha) in orchards, 34
individuals per 100 acres in edge communities with shrubs, 25
individuals per 100 acres in residential areas (lawns etc.), and 13
individuals per 100 acres in second-growth woods [25].

In central hardwood forests eastern bluebirds are common in regenerating
stands (seedling-shrub stage) but are not present in later successional
stages.  In loblolly-shortleaf pine (Pinus taeda-P. palustris) forests,
they are uncommon in regeneration and sapling stages and present in
old-growth stages but not present in pole and mature stands (possibly
because of the presence of snags) [17].

In the Southeast, red-cockaded woodpecker (Picoides borealis) holes are
used successively by other woodpeckers (Picidae), flycatchers (Empidonax
spp.), titmice (Parus spp.), and eastern bluebirds.  Squirrels and
chipmunks (Sciuridae) are also aggressive users of woodpecker holes
[15].  Pileated woodpeckers (Drycopus pileatus) sometimes make holes too
large to be used by some species, but eastern bluebirds use most of the
holes [5].

Winter habitats used by eastern bluebirds usually contain fruit-bearing
plants; these include open pine-oak woodlands, pastures (especially saw
palmetto (Serenoa repens)-pineland threeawn (Aristida stricta) in the
Southeast), open pine woodlands, and old fields [41].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Rangeland Cover Types

More info on this topic.

This species is known to occur in association with the following Rangeland Cover Types (as classified by the Society for Range Management, SRM):

More info for the term: hardwood

   601  Bluestem prairie
   602  Bluestem-prairie sandreed
   603  Prairie sandreed-needlegrass
   604  Bluestem-grama prairie
   606  Wheatgrass-bluestem-needlegrass
   608  Wheatgrass-grama-needlegrass
   609  Wheatgrass-grama
   610  Wheatgrass
   611  Blue grama-buffalograss
   612  Sagebrush-grass
   708  Bluestem-dropseed
   709  Bluestem-grama
   710  Bluestem prairie
   711  Bluestem-sacahuista prairie
   717  Little bluestem-Indiangrass-Texas wintergrass
   720  Sand bluestem-little bluestem (dunes)
   721  Sand bluestem-little bluestem (plains)
   731  Cross timbers-Oklahoma
   732  Cross timbers-Texas (little bluestem-post oak)
   801  Savanna
   802  Missouri prairie
   804  Tall fescue
   809  Mixed hardwood and pine
   810  Longleaf pine-turkey oak hills
   811  South Florida flatwoods
   812  North Florida flatwoods

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Cover Types

More info on this topic.

This species is known to occur in association with the following cover types (as classified by the Society of American Foresters):

     1  Jack pine
    14  Northern pin oak
    15  Red pine
    20  White pine-northern red oak-red maple
    21  Eastern white pine
    40  Post oak-blackjack oak
    42  Bur oak
    43  Bear oak
    44  Chestnut oak
    45  Pitch pine
    46  Eastern redcedar
    50  Black locust
    51  White pine-chestnut oak
    52  White oak-black oak-northern red oak
    53  White oak
    55  Northern red oak
    64  Sassafras-persimmon
    67  Mohrs (shin) oak
    70  Longleaf pine
    71  Longleaf pine-scrub oak
    72  Southern scrub oak
    74  Cabbage palmetto
    75  Shortleaf pine
    76  Shortleaf pine-oak
    78  Virginia pine-oak
    79  Virginia pine
    80  Loblolly pine-shortleaf pine
    81  Loblolly pine
    82  Loblolly pine-hardwood
    83  Longleaf pine-slash pine
    84  Slash pine
    85  Slash pine-hardwood
   109  Hawthorn
   110  Black oak
   111  South Florida slash pine

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Ecosystem

More info on this topic.

This species is known to occur in the following ecosystem types (as named by the U.S. Forest Service in their Forest and Range Ecosystem [FRES] Type classification):

FRES10 White-red-jack pine
FRES12 Longleaf-slash pine
FRES13 Loblolly-shortleaf pine
FRES14 Oak-pine
FRES15 Oak-hickory
FRES39 Prairie

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat: Plant Associations

More info on this topic.

This species is known to occur in association with the following plant community types (as classified by Küchler 1964):

   K070  Sandsage-bluestem prairie
   K074  Bluestem prairie
   K075  Nebraska Sandhills prairie
   K076  Blackland prairie
   K077  Bluestem-sacahuista prairie
   K081  Oak savanna
   K082  Mosaic of K074 and K100
   K083  Cedar glades
   K084  Cross Timbers
   K088  Fayette prairie
   K089  Black Belt
   K095  Great Lakes pine forest
   K100  Oak-hickory forest
   K104  Appalachian oak forest
   K110  Northeastern oak-pine forest
   K111  Oak-hickory-pine forest
   K112  Southern mixed forest
   K116  Subtropical pine forest

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Breeding populations in the northern U.S. and Canada move south for winter. Northward migrants arrive in northern breeding areas mostly in March-April, sometimes late February. Southward migration is mainly September-November.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Eastern bluebirds eat a variety of foods depending on the season. In summer months, eastern bluebirds consume mostly beetles (order Coleoptera), crickets, caterpillars, grasshoppers, and other insects. A United States Biological Survey study of 855 eastern bluebirds found that the bluebird diet was 68% insects. During the fall and winter seasons, when insects are less common, eastern bluebirds eat fruits and plants, including blackberries, honeysuckle, dogwood, red cedar, and wild grapes.

Eastern bluebirds drink water from ponds, streams and birdbaths. They appear to prefer running water versus standing water.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Primary Diet: carnivore (Insectivore )

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Eats mainly insects, also other invertebrates and small fruits; often flies from low perch to ground to feed on Orthoptera and beetles (Terres 1980); also gleans from foliage.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

Eastern bluebirds eat a variety of foods depending on the season. In summer months, eastern bluebirds consume mostly beetles (order Coleoptera), crickets, caterpillars, grasshoppers, and other insects. A United States Biological Survey study of 855 eastern bluebirds found that the bluebird diet was 68% insects. During the fall and winter seasons, when insects are less common, eastern bluebirds eat fruits and plants, including blackberries, honeysuckle, dogwood, red cedar, and wild grapes.

Eastern bluebirds drink water from ponds, streams and birdbaths. They appear to prefer running water versus standing water.

Animal Foods: insects

Plant Foods: seeds, grains, and nuts; fruit

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Food Habits

A large proportion of the eastern bluebird diet consists of arthropods,
most frequently grasshoppers and crickets, but also butterflies and
moths, spiders, and beetles [46].  Preferences of captive eastern
bluebirds included (in order) mealworms, crickets, grasshoppers, leaf
hoppers, locusts, sow bugs, and stink bugs.  Wild eastern bluebirds also
consume earthworms, May beetles, and caterpillars [41].  In Tennessee
eastern bluebirds continue to hunt for arthropods in winter; even on
cold days some arthropods, especially spiders, may be active on
south-facing slopes. When air and soil temperatures are below 32 degrees
Fahrenheit (0 deg C), insect activity (and therefore availability) is
extremely limited [52].  In northwestern Tennessee droppings collected
from nest boxes used as roost sites on the coldest days in winter
contained only plant materials.  Insects are inactive on these very cold
days [51,52].

Eastern bluebirds rely heavily on fruit in nonbreeding seasons when it
is available.  Fruit is usually scarce in the early part of the breeding
season.  In southern Michigan staghorn sumac and smooth sumac (Rhus
glabra) fruits are frequently consumed [44,46].  Fruits of chokecherry,
black cherry, multiflora rose, and flameleaf sumac (R. coppalina) are
also common dietary components [41].  In northwestern Tennessee in
winter, eastern bluebirds consume the fruit of sumacs (Rhus spp.),
flowering dogwood, grapes (Vitis spp.), Japanese honeysuckle (Lonicera
japonica), hackberry (Celtis spp.), rose (Rosa spp.), deciduous holly
(Ilex decidua), pokeweed (Phytolacca americana), greenbriers (Smilax
spp.), and climbing bittersweet (Celastrus scandens) [52].  In Florida
fruits eaten in the nonbreeding seasons include those of greenbriers,
smooth sumac, and juneberry (Amelanchier spp.).  Earthworms and
caterpillars are also consumed when available [41].

Nestlings are fed caterpillars, grasshoppers and crickets, spiders, and
(usually for older nestlings and fledglings) succulent early-maturing
fruits such as mulberries (Morus spp.), raspberries (Rubus spp.),
dogwood (Cornus spp.) fruits, cherries (Prunus spp.), and honeysuckle
berries (Lonicera spp.) [46].

Foraging Techniques:  The most common foraging technique is dropping
from a perch to capture already-spotted prey on or near the ground.
Eastern bluebirds also forage by flycatching, foliage hovering, and
rarely, gleaning [22,41,42,44,46].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Eastern bluebirds influence the composition of insect communities through their predation on insects. They also host many species of parasites, including mites, lice and blowflies.

Eastern bluebirds affect communities of the insects they eat. They also provide habitat for many species of parasites, including mites, lice and blowflies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern chipmunks and flying squirrels prey on eastern bluebird eggs and nestlings. House sparrows, European starlings, American kestrels  black rat snakes, black racers, fire ants, domestic cats, black bears, and raccoons are predators of adults and chicks.

When approached by a predator, male eastern bluebirds make a song-like warning cry. If a male is not present, a female will begin to sing, hoping to attract a protective male back to the territory. Both males and females will also flick their wings and warble when predators are nearby.

Known Predators:

  • eastern chipmunks (Tamias striatus)
  • southern flying squirrels (Glaucomys volans)
  • house sparrows (Passer domesticus)
  • European starlings (Sturnus vulgaris)
  • American kestrels (Falco sparverius)
  • black rat snakes (Pantherophis obsoletus)
  • black racers (Coluber)
  • fire ants (Solenopsis invicta)
  • domestic cats (Felis silvestris)
  • American black bears (Ursus americanus)
  • raccoons (Procyon lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecosystem Roles

Eastern bluebirds affect communities of the insects they eat. They also provide habitat for many species of parasites, including mites, lice and blowflies.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predation

Tamias striatus and Glaucomys volans prey on eastern bluebird eggs and nestlings. Passer domesticus, Sturnus vulgaris, Falco sparverius  Elaphe obsoleta, Coluber, Solenopsis invicta, Felis silvestris, Ursus americanus, and Procyon lotor are predators of adults and chicks.

When approached by a predator, male eastern bluebirds make a song-like warning cry. If a male is not present, a female will begin to sing, hoping to attract a protective male back to the territory. Both males and females will also flick their wings and warble when predators are nearby.

Known Predators:

  • eastern chipmunks (Tamias_striatus)
  • southern flying squirrels (Glaucomys_volans)
  • house sparrows (Passer_domesticus)
  • European starlings (Sturnus_vulgaris)
  • American kestrels (Falco_sparverius)
  • black rat snakes (Elaphe_obsoleta)
  • black racers (Coluber)
  • fire ants (Solenopsis_invicta)
  • domestic cats (Felis_silvestris)
  • American black bears (Ursus_americanus)
  • raccoons (Procyon_lotor)

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Predators

Most nest failures are due to predation and/or nest site competitors.
In southern Michigan 23 percent of nest box failures was due to house
wrens (Troglodytes aedon) puncturing eggs or removing them; 18.8 percent
was due to raccoons (Procyon lotor) or other mammals, and 14 percent to
weather [45].  In that study raccoons had to be controlled before
successful eastern bluebird nesting occurred [41].  Eastern bluebird
nestlings were killed and partially eaten by an eastern chipmunks
(Tamias striatus) [38].  Red squirrels (Tamiasciurus hudsonicus) kill
adult eastern bluebirds and rob eggs.  House sparrows (Passer
domesticus) kill adult eastern bluebirds in nest boxes in competition
for nest sites [41].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

General Ecology

Habitat-related Fire Effects

More info for the terms: fresh, natural, prescribed fire, shrubs, understory fire

The eastern bluebird is known as a fire-follower [1,16,35,62]; the low
sparse vegetation on fresh burns and plentiful natural cavities caused
by decay in fire injured or killed trees are important for eastern
bluebird habitat [36,41].  In southern pine forests, fire retards
succession, reduces midstory hardwoods and shrubs, and favors herbaceous
vegetation; all of these effects enhance eastern bluebird habitat [16].

An important consideration is the effect of fire on food sources.  Fire
often reduces understory fruit production [33].  There are conflicting
reports on the effect of fire on arthropod populations [16].  The
effects of fire on invertebrate populations may be transitory or long
lasting.  There is usually an immediate decrease in invertebrates due to
direct mortality and indirectly due to loss of food supplies and
shelter.  In some instances flying insects are attracted by heat, smoke,
or killed or damaged trees, and therefore populations of some species may
increase during and after a fire.  Fires reduce the populations of most
soil fauna (animals that spend most of their time on the forest floor or
mineral soils).  The length of time of this effect varies with fire
severity and postfire vegetation [36].

The Research Project Summary Effects of understory fire on cavity-nesting
birds in Arizona pine forests
provides information on prescribed fire effects
in Arizona pine (Pinus ponderosa var. arizonica) forest where eastern
bluebird was present.

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Timing of Major Life History Events

More info for the terms: altricial, polygyny, presence

The eastern bluebird is nonmigratory in many parts of its range.  This
trait confers an advantage over migratory competitors for limited nest
sites.  Eastern bluebirds and mountain bluebirds (Sialia currucoides)
may occupy the same nest site in different years [46].

Spring Migration and Territory Establishment:  Eastern bluebirds and
western bluebirds (Sialia mexicana) are similar in habitat requirements
and exhibit interspecific territoriality [37], as do eastern bluebirds
and mountain bluebirds in areas of sympatry.  Eastern bluebird territory
size varies seasonally.  In Michigan eastern bluebird territories are
largest in March and become progressively smaller through April, May,
and June [46].  Nonmigratory males establish territories from February
20 to March 10.  Other males arrive and establish territories from late
March to early April [48].  Females arrived after males in 1970, 1971,
and 1974 [46].  Krieg [29] however, reported that in northwestern New
York, the general pattern was a staggered arrival of male and female
birds from mid-March to early June.  Some birds arrived already paired,
others were unpaired [29].  In New York males choose territories in
mid-March [60].  Each territory is established around at least one nest
site and is usually expanded to include several potential nest sites
[29].  Territories may be established as long as 6 weeks or as little as
an hour before nest building occurs [71].  The males display and sing at
several nest sites to attract females.  After a female accepts a
particular site, she builds the nest out of dry grasses or other plant
materials; sometimes several nests are built in different sites before
eggs are laid in the final site [29,41].  Nest building usually takes 5
or 6 days, but may take 2 weeks or more; on occasion nests are built in
1 day or less and egg-laying commences immediately [71].  Eastern
bluebirds do not exhibit strong nest-site fidelity [48].

Eggs:  Egg laying normally starts soon after the nest completion, but
delays of more than a week are not unusual [71].  In southern Michigan
egg-laying activity begins in early April, with complete clutches
present as early as April 8.  Egg-laying activity (in a population)
usually peaks the third week of April and again the third week of June.
One egg is laid per day, usually with 1 or more days between eggs.  The
typical eastern bluebird clutch is three to five eggs, occasionally six
[41,71].  Incubation only begins after the clutch is complete [71].  The
female usually does all the incubation, and is either fed by the male or
takes short foraging trips [41,45].  Incubation lasts 13 to 15 days, and
ranges from 12 to 21 days [41].  In New York first broods usually hatch
at 14 days and later broods take 13 days, probably because of higher
temperatures [71].

Development of Young:  In New York first broods hatch in early May.  The
naked, altricial hatchlings are blind [60].  They are brooded almost
constantly by the female for the first few days; brooding becomes more
sporadic after feather growth commences, and ceases a few days before
the young leave the nest.  Brooding intensity varies with weather [71].
Both parents feed nestlings and remove fecal sacs [22,60].  Fledging
occurs from 15 to 20 days after hatching [41], most commonly at 17 or 18
days.  First flights are usually directly to a perch, and are 50 to 100
feet (15-30 m) in length.  Fledglings stay near the nest and each other,
roosting together at night.  Parents feed the fledglings, who begin to
find their own food about 2 weeks after fledging and achieve
independence 3 to 3.5 weeks after fledging.  Widowed females often
continue to raise the brood, often with help from unmated females and
immatures (often members of earlier broods).  Widowed males attempt to
raise broods if nestlings are well feathered; they also often have
helpers [71].

About 10 days after the first brood fledges, the female usually builds a
new nest (often in the same site) and lays a second clutch.  The male
continues to feed the young of the first brood; when the second brood
hatches the male and sometimes members of the first brood help feed the
nestlings [29,60].

Multiple Broods:  Eastern bluebirds often produce three broods in one
season in the central part of their range.  They are single-brooded on
the northern periphery, and usually double-brooded elsewhere [40].  In
southern Michigan there are two main nesting periods.  The spring
nesting period peaks from April 6 to May 14 and is fairly synchronized
(that is, most eastern bluebirds in the area are nesting at this time).
The summer nesting period occurs from June 7 to July 23.  Eastern
bluebirds nesting during the spring period usually attempt a second
brood in the summer period.  However, there is an intermediate period,
from May 15 to June 6.  Eastern bluebirds nesting in this period are
usually only able to raise a single brood [47].  Nesting success is
greatest in the intermediate period, but spring broods are bigger;
overall more fledglings are produced from spring broods [45]. 

Two or three broods in a season is typical for many populations of
eastern bluebirds; however, there are a number of reported instances of
the production of four clutches or broods.  A single pair of eastern
bluebirds produced four clutches in one season but only the first three
produced fledglings [32].  In Alabama a male eastern bluebird
successfully reared four broods in 1987.  This male apparently mated
with two different females, raising two broods with each female.  It is
possible that he was a helper rather than a parent with one of the
females; genetic relationships were undetermined [65].  In northeastern
Texas a single pair of eastern bluebirds (nonmigratory) successfully
raised four broods:  four eggs, one hatchling, one fledgling April 14;
five eggs, two hatchlings, two fledglings June 1; five eggs, one
hatchling, one fledgling July 12; and four eggs, four hatchlings, and
four fledglings August 22 [30].  Eastern bluebirds are predominantly
monogamous (one male and one female are the genetic parents of all
members of a brood) but polygyny has also been observed [23,24].

Fall Migration: The presence of fruit determines eastern bluebird
distribution in winter [41].  In winter eastern bluebirds are found
mainly in the southern half or two-thirds of the breeding range [71].
In southern Michigan probably close to 95 percent of eastern bluebirds
migrate southward; in some areas all of the eastern bluebirds migrate
[41,45].  The proportion of eastern bluebirds migrating decreases with
decreasing latitude [41].  Southward migration of eastern bluebird
flocks is usually leisurely as the birds search for food [71].  In New
York parents and both broods remain together in summer and fall, then
join larger flocks in the fall which move southward, stopping frequently
where food is plentiful.  New York State eastern bluebirds travel as far
south as Virginia and North Carolina [60].  In Tennessee eastern
bluebirds that are present during the breeding season are usually
nonmigratory.  They form small flocks of adults and immature birds in
late summer and stay together most of the nonbreeding season [52].

Nesting Success and Productivity:  Pinkowski [45] reported that eastern
bluebird achieved 56 percent nesting success in Michigan (nesting
success is defined as the proportion of nests producing at least one
fledgling).  Mean annual productivity for eastern bluebirds nesting in
southern Michigan, over a 10-year study, was five fledged young per pair
per season.  Estimated survival rates were 82 percent between fledging
and independence, 33 percent between independence and the start of the
next breeding season, and 50 percent thereafter (on an annual basis)
[47].  In west-central Wisconsin nest boxes placed on managed lands, 45
eastern bluebird nests produced an average of 1.2 fledged young per
nesting attempt [67].  Blowfly parasitism reduces nest productivity; it
is a serious problem in some areas [73].

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Eastern bluebirds communicate primarily through sounds. One of the most distinguishing characteristics of this species, aside from its distinctive coloring, is its song. Bluebirds have different songs for mating, territoriality, and other purposes. When heard, the most common call of the bluebird sounds like -chir wi- or -chur lee-. When repeated several times, the call resembles the words -truly- and -purity-. Eastern bluebirds also use visual cues to communicate.

Communication Channels: visual ; acoustic

Perception Channels: visual ; tactile ; acoustic ; chemical

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Communication and Perception

Eastern bluebirds communicate mostly through sounds. They have different songs for mating, territoriality, and other purposes. The most common call of the bluebird sounds like -chir wi- or -chur lee-. When repeated several times, the call sounds like the words -truly- and -purity-. Eastern bluebirds also use body signals to communicate.

Communication Channels: visual ; acoustic

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Eastern bluebirds can live up to 6 to 10 years. The oldest known wild individual lived 10 years and 5 months. However, most mortality occurs in the first year of life, making average lifespans much shorter than this.

Range lifespan

Status: wild:
10.4 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan/Longevity

Eastern bluebirds can live up to 6 to 10 years. The oldest known wild individual lived 10 years and 5 months. However, most mortality occurs in the first year of life, making average lifespans much shorter than this.

Range lifespan

Status: wild:
10.4 (high) years.

Average lifespan

Status: wild:
125 months.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 10.4 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eastern bluebirds are generally monogamous. However, some studies have shown that more than one female or male are involved in some broods, suggesting that monogamy is not always the rule in this species. Occasionally, juveniles of a first brood remain near the nest to help the parents raise a second brood. This behavior is uncommon among eastern bluebird. Juvenile helpers are much more common among western bluebirds.

Mating System: monogamous ; cooperative breeder

Mating occurs in the spring and summer months. A mature female will typically raise two broods each season. Nests are constructed in trees within abandoned woodpecker holes or other cavities that provide adequate protection (usually several feet above ground). Construction of the nest is done primarily by the female and takes approximately 10 days to complete. These nests are small, cup-like structures that are lined with grass, feathers, stems, and hairs. Each female lays 3 to 7 (average 4 to 5) light-blue or, rarely, white eggs. The female incubates the eggs, which hatch after 13 to 16 days. The young are altricial at hatching. Fledglings leave the nest 15 to 20 days after hatching. Several studies have revealed that some young will stay around the nest to help raise another brood.

Both parents cooperate in raising the young, which they feed a diet insects. Fledglings are grayish in color with a speckled breast. The blue color becomes much more prominent and the speckles on their breast disappear as they mature. Bluebirds may begin breeding the summer after they are hatched.

Breeding interval: A mature female typically raises two broods each season.

Breeding season: Eastern bluebirds breed in the spring and summer.

Range eggs per season: 3 to 7.

Range time to hatching: 13 to 16 days.

Range fledging age: 15 to 20 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: iteroparous ; seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); sexual ; oviparous

Average eggs per season: 4.

The young are altricial, meaning they cannot care for themselves upon hatching. Both parents cooperate in raising the young. The female broods the chicks for up to 7 days after hatching. Both parents feed the chicks while they are in the nest and for about three weeks after they have left the nest. The chicks are fed mainly insects.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Gowaty, P., J. Plissner. 1998. Eastern Bluebird (Sialis sialis). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 381. Philadelphia, PA: The Birds of North America, Inc.
  • North American Bluebird Society, 1999. "Fact Sheet: Getting Started with Bluebirds" (On-line). Accessed December 1, 1999 at http://www.nabluebirdsociety.org/start.htm.
  • Tveten, J. 1993. Birds of Texas. Fredricksburg, TX: Shearer Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Nesting period varies with location and may begin as early as late February in some areas and extends into late summer. Clutch size is usually 4-5. Individual females in most areas produce 2 broods/year, sometimes 3, very rarely 4. Incubation, mainly by the female, lasts 12-16 days. Young are tended by both parents, leave nest at 15-20 days. Male tends fledged young if female renests. Young of the first brood may help feed the second brood.

Males and females of nesting pairs of eastern bluebirds commonly engage in copulations with other eastern bluebirds. As a result, some nests contain nestlings with different fathers.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eastern bluebirds are usually monogamous (one male mates with one female). Occasionally, one male will mate with two females. Sometimes, young bluebirds from one brood will stay near the nest to help their parents raise a second brood. However, this is not very common. Helpers are much more common among Sialia mexicana.

Mating System: monogamous ; cooperative breeder

Eastern bluebirds mate in spring and summer. A mature female will typically raise two broods each season. Females do most of the nest building over about 10 days. The nests are cup-shaped, and lined with soft grass. They are built in abandoned woodpecker holes or other cavities that provide protection (usually several feet above ground). Each female lays 3 to 7 (on average 4 or 5) light-blue eggs. The female then incubates the eggs, which means that she sits on them to keep them warm until they hatch. The eggs hatch 13 to 16 days after being laid. The chicks are altricial (helpless) when they hatch. The female broods the chicks to keep them warm, and both parents feed them insects. The fledglings leave the nest 15 to 20 days after hatching. Several studies have shown that some young stay around the nest to help their parents care for a second clutch. Young bluebirds may begin mating when they are one year old.

Breeding interval: A mature female typically raises two broods each season.

Breeding season: Eastern bluebirds breed in the spring and summer.

Range eggs per season: 3 to 7.

Range time to hatching: 13 to 16 days.

Range fledging age: 15 to 20 days.

Average age at sexual or reproductive maturity (female): 1 years.

Average age at sexual or reproductive maturity (male): 1 years.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate)

Average eggs per season: 4.

The young are altricial, meaning they cannot care for themselves upon hatching. Both parents cooperate in raising the young. The female broods the chicks for up to 7 days after hatching. Both parents feed the chicks while they are in the nest and for about three weeks after they have left the nest. The chicks are fed mainly insects.

Parental Investment: altricial ; pre-fertilization (Provisioning, Protecting: Female); pre-hatching/birth (Protecting: Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Female); pre-independence (Provisioning: Male, Female)

  • Gowaty, P., J. Plissner. 1998. Eastern Bluebird (Sialis_sialis). Pp. 1-32 in A Poole, F Gill, eds. The Birds of North America, Vol. 381. Philadelphia, PA: The Birds of North America, Inc.
  • North American Bluebird Society, 1999. "Fact Sheet: Getting Started with Bluebirds" (On-line). Accessed December 1, 1999 at http://www.nabluebirdsociety.org/start.htm.
  • Tveten, J. 1993. Birds of Texas. Fredricksburg, TX: Shearer Publications.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: BioKIDS Critter Catalog

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Feathers produce non-iridescent colors: eastern bluebirds
 

Feathers of eastern bluebirds produce non-iridescent colors using self-assembled, quasi-ordered nanostructures.

     
  "Some of the most vivid colors in the animal kingdom are created not by pigments, but by wavelength-selective scattering of light from nanostructures. Here we investigate quasi-ordered nanostructures of avian feather barbs which produce vivid non-iridescent colors. These β-keratin and air nanostructures are found in two basic morphologies: tortuous channels and amorphous packings of spheres. Each class of nanostructure is isotropic and has a pronounced characteristic length scale of variation in composition. These local structural correlations lead to strong backscattering over a narrow range of optical frequencies and little variation with angle of incidence. Such optical properties play important roles in social and sexual communication. To be effective, birds need to precisely control the development of these nanoscale structures, yet little is known about how they grow. We hypothesize that multiple lineages of birds have convergently evolved to exploit phase separation and kinetic arrest to self-assemble spongy color-producing nanostructures in feather barbs. Observed avian nanostructures are strikingly similar to those self-assembled during the phase separation of fluid mixtures; the channel and sphere morphologies are characteristic of phase separation by spinodal decomposition and nucleation and growth, respectively. These unstable structures are locked-in by the kinetic arrest of the β-keratin matrix, likely through the entanglement or cross-linking of supermolecular β-keratin fibers. Using the power of self-assembly, birds can robustly realize a diverse range of nanoscopic morphologies with relatively small physical and chemical changes during feather development." (Dufresne et al. 2009:1792)
  Learn more about this functional adaptation.
  • Dufresne ER; Noh H; Saranathan V; Mochrie SGJ; Cao H; Prum RO. 2009. Self-assembly of amorphous biophotonic nanostructures by phase separation. Soft Matter. 5: 1792-1795.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Sialia sialis

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 7 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

GTGACATTCATCAACCGGTGATTATTCTCAACCAACCACAAAGACATTGGCACTCTCTACCTAATCTTTGGTGCATGAGCCGGCATAGTCGGCACCGCCCTAAGTATTCTCATCCGAGCCGAATTAGGACAACCCGGTGCCCTTCTAGGCGATGACCAAGTGTACAATGTAATTGTTACCGCCCATGCCTTCGTAATAATCTTCTTTATAGTAATACCAATCATAATCGGAGGATTTGGAAACTGATTAGTCCCACTAATAATCGGAGCCCCAGATATAGCATTCCCCCGAATAAACAACATGAGCTTCTGACTTCTTCCCCCCTCCTTCCTCCTACTACTCGCTTCCTCCACAGTAGAAGCTGGAGTCGGAACAGGCTGAACTGTCTACCCACCCCTCGCTGGCAACCTAGCCCACGCAGGAGCCTCAGTAGACCTTGCCATCTTTTCCCTTCACCTAGCAGGGATCTCTTCAATCCTAGGGGCTATCAACTTCATTACCACAGCAATCAACATGAAACCCCCTGCCCTTTCACAATACCAAACCCCCCTATTCGTCTGATCAGTACTAATCACTGCTGTCCTACTCCTCCTCTCTCTACCCGTTCTAGCCGCTGGCATCACTATGCTCCTCACCGACCGCAACCTAAACACAACCTTCTTCGACCCCGCAGGAGGAGGGGACCCTGTACTCTACCAACACCTGTTCTGATTCTTTGGCCACCCCGAAGTGTACATCCT
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Sialia sialis

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 7
Specimens with Barcodes: 11
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5