Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Catharus fuscescens

Paler and less heavily-streaked than the other thrushes breeding in North America, the Veery (6 ½ - 7 ½ inches) is most easily identified by its tawny-colored back and head. Other field marks include pink legs, white breast, and dark eye lacking any noticeable eye-ring. Male and female Veerys are similar to one another in all seasons. The Veery breeds across southern Canada and the northern U.S. Smaller populations occur at higher elevations in the Rockies and the Appalachians south to New Mexico and Georgia, respectively. This species is a long-distance migrant, breeding in southeastern Brazil. In summer, Veerys breed in wet deciduous forests. On migration, this species may be found in the undergrowth of various kinds of forests across North America. Little is known about the Veery’s habitat preferences in winter due to the relative inaccessibility of its winter range, but all records for this species at that time of year come from dense tropical forests. Veerys eat fruits, berries, and insects during the breeding season; fruits are presumed to make up a large part of this species’ diet on winter grounds. The vast majority of North American birders, including many scientists, never see the Veery in its winter range. This species is much easier to observe in summer and on migration, although it is more often heard than seen due to its preference for habitats with thick vegetation. Veerys may be observed foraging food while hopping along the forest floor or through the branches of trees. Males may be located by listening for their unique, onomatopoeic song. The Veery is most active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least Concern

  • Bevier, Louis R., Alan F. Poole and William Moskoff. 2005. Veery (Catharus fuscescens), The Birds of North America Online (A. Poole, Ed.). Ithaca: Cornell Lab of Ornithology; Retrieved from the Birds of North America Online: http://bna.birds.cornell.edu/bna/species/142
  • Catharus fuscescens. Xeno-canto. Xeno-canto Foundation, n.d. Web. 20 July 2012. .
  • Peterson, Roger Tory. Birds of Eastern and Central North America. Boston: Houghton Mifflin, 1980. Print.
  • Veery (Catharus fuscescens). The Internet Bird Collection. Lynx Edicions, n.d. Web. 20 July 2012. .
  • eBird Range Map - Veery. eBird. Cornell Lab of Ornithology, N.d. Web. 20 July 2012. .
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Smithsonian Institution

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Nesting range extends from southern British Columbia across southern Canada to Nova Scotia and southwestern Newfoundland, south to central Oregon, Colorado, South Dakota, southern Great Lakes region, and New Jersey, and in the Appalachians to northern Georgia; also east-central Arizona and probably northern New Mexico (Moskoff 1995, AOU 1998).

Winter range may be restricted to three small areas in south-central and southeastern Brazil, at the periphery of or south of the Amazon basin (Remsen 2001). Formerly the species was thought to winter in South America from Guyana, northern Venezuela, and eastern Colombia to Amazonian Brazil and northern Bolivia (Cochabamba and Santa Cruz) (a few records from Peru and Chile) (Hilty and Brown 1986, Ridgely and Tudor 1989, Moskoff 1995).

Range extent score reflects nonbreeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 18 cm

Weight: 31 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Veeries (Catharus fuscens) are medium-sized thrushes with a body shape similar to that of an American Robin. Overall, they have a plump body and rounded head with a straight, narrow bill (Cornell Lab of Ornithology, 2015). Typical length from bill to tail tip is 7 inches while average wingspan is 12 inches. Veeries have reddish-brown upperparts, a thin pale eye ring, a faintly streaked buff throat and upper breast, light underparts, gray flanks and face patch, and pinkish legs (McCormac and Kennedy, 2004). Veeries express regional differences that may complicate the process of identification. In Newfoundland and the far-western portion of their range (British Columbia, Alberta, Oregon, Montana, and Idaho), Veery populations have darker upperparts and more pronounced breast spotting, which may make them appear more like a Swainson’s Thrush or Gray-cheeked Thrush (Cornell Lab of Ornithology, 2015).

Overall, Veeries are easier to identify than other thrushes in their genus (Catharus) due to their reddish-brown upperparts. However, Veeries can be mistaken for similar species including: Hermit Thrush (Catharus guttatus), Wood Thrush (Hylocichla mustelina), Gray-cheeked Thrush (Catharus minimus), Swainson’s Thrush (Catharus ustulatus) and Brown Thrasher (Toxostoma rufum). In comparison to Veeries, Hermit Thrushes have a warm reddish-brown tail, lighter brown back and perform habitual tail bobbing. Wood Thrushes express more pronounced spotting on the chest and belly; they also tend to be plumper than Veeries. Gray-cheeked Thrushes are grayer overall and lack the warm reddish brown color of the Veery. Because of their gray color, Gray-cheeked Thrushes are more readily differentiated from Veeries, however, identification can be difficult in some portions of Veery range. Swainson’s Thrushes tend to be more olive brown in color with more pronounced chest spots and a spectacle-like, buff-colored eye ring. Brown Thrashers are larger with a longer, more curved bill and tail. Compared to Veeries, Brown Thrashers also exhibit yellow eyes and darker streaking on the chest and belly (Cornell Lab of Ornithology, 2015).

  • Cornell Lab of Ornithology (2015). Veery (Catharus fuscescens). Retrieved from: http://www.allaboutbirds.org/guide/Veery/id
  • McCormac, J.S. and Kennedy, G. (2004) Birds of Ohio. Auburn, Washington: Lone Pine Publishing International.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Maria Dellapina, Haley Lloyd; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Differs from other thrushes in having less breast spotting (less distinct and more restricted). Differs from Pacific coast populations of Swainson's thrush (CATHARUS USTULATUS) in having gray (vs. buffy brown) flanks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

During the breeding season, Veeries occupy moist, dense, deciduous forests of North America (Kaufman, 2014; Heckscher, 2011). In the southern parts of their breeding range, Veeries inhabit cooler microclimates. These cool microclimates are most commonly located at high elevations on north-facing slopes and in wet depressions (Burleigh, 1927). The Veery is a Neotropical migrant, and travels to South America where it takes up winter residence. While in their wintering grounds, it is typical to find Veeries in the undergrowth of lowland tropical forests (Kaufman, 2014). In 2001, Remsen hypothesized that the Veery’s winter range surrounds two separate areas in Brazil. More specifically, Remsen (2001) suggests that the winter range of the Veery is very large and includes tropical South America east of the Andes and also parts of Central America. The results of such investigations suggest that the winter range of the Veery is so extensive that it may encompass some of the largest wilderness areas remaining on the planet today, including portions of western Amazonia and surrounding regions (Remsen, 2001).

Heckscher et al. (2011) found that two of five geo-tracked Veeries displayed inconsistent movement when compared with that of traditional migratory behavior. Such inconsistent behavior included the arrival at wintering grounds and then subsequent movement to another region of suitable habitat. The second movement was referred to as a “second winter.” It was hypothesized following this discovery that the Veeries migrated in such a manner because of seasonal flooding of lowland forests in Amazonia. These data therefore suggest that Veeries are possibly intolerant of flooded or swamp-like habitat.

While foraging, Veeries are usually located in habitats containing shrubs in hardwood forest understories and midstories (Paszkowski, 1984). In forests located in the southeastern portion of New York, Veeries frequently build nests in exotic shrubs such as Japanese Barberry (Berberis thunbergii) (Schmidt et al., 2005). Such results indicate that Veeries can be rather tolerant of invasive plant species. Overall, habitat preferences investigated by Bertin (1977) indicate that in mature woodlands containing Veery, understory cover and proximity to running water may be less important than mesic habitats, therefore suggesting that moisture content may be a factor driving such preferences.

  • Bertin, R. I. (1977). Breeding habitats of the Wood Thrush and Veery. Condor, 303-311.
  • Burleigh, T. D. (1927). Further notes on the breeding birds of northeastern Georgia. The Auk 44, 229-234.
  • Heckscher, C. M., Taylor, S. M., Fox, J. W., and Afanasyev, V. (2011) Veery (Catharus fuscescens) wintering locations, migratory connectivity, and a revision of its winter range using geolocator technology. The Auk 128 (3), 531-542.
  • Kaufman, K. (2014). Veery. National Audubon Society: Guide to North American Birds. Retrieved October 6, 2015, from http://www.audubon.org/field-guide/bird/veery
  • Paszkowski, C. A. (1984). Macrohabitat use, microhabitat use, and foraging behavior of the Hermit Thrush and Veery in a northern Wisconsin forest. The Wilson Bulletin, 286-292.
  • Remsen, J. V. Jr. (2001) True winter range of the Veery (Catharus fuscescens): Lessons for determining winter ranges of species that winter in the tropics. The Auk 118 (4), 838-848.
  • Schmidt, K. A., Nelis, L. C., Briggs, N., & Ostfeld, R. S. (2005). Invasive shrubs and songbird nesting success: effects of climate variability and predator abundance. Ecological Applications, 15(1), 258-265.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Maria Dellapina, Haley Lloyd; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Comments: Nesting habitat includes swampy forest, especially in more open areas with shrubby understory, as well as second growth, willow or alder shrubbery near water; large tracts of forest are most suitable. Nests usually are on or near the ground, at the base of a shrub, in a clump of herbaceous vegetation, or in a shrub or low tree (Terres 1980). In migration and winter this species occurs also in lowland forest, woodland, and scrub.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Veery arrives in the southern U.S. in April, still common in migration mid-May, on northern nesting grounds by late April-early May (Terres 1980). Costa Rica: uncommon to sporadically common fall transient (late September-late October), rare spring transient (March-April) (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes insects and other invertebrates and small fruits; foraging occurs on forest floors and in trees (Terres 1980), often near water (Stiles and Skutch 1989). This species eats many fruits during migration (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Catharus fuscescens (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) is prey of:
Accipiter striatus
Accipiter cooperii
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Catharus fuscescens (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) preys on:
Araneae
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 1,000,000. Rich et al. (2004) estimated population size at 14,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Behavior

Veeries tend to behave in an inconspicuous manner; however, males are often the exception, emitting a beautifully complex song for which the species is named (Cornell Lab of Ornithology, 2015).  Male Veeries emit a cascading resonant song of da-vee-ur, vee-ur, vee-ur, veer veer. The song itself is rather complex, exhibiting a wide range of frequencies, patterns and phrases. Despite these variations, the standard Veery song has two main parts: 1) an ascending introductory note and 2) a series of descending similar phrases (Samuel, 1972). Belinsky et al. (2015) found that male Veeries tend to modulate their song in aggressive contexts, specifically while protecting territory from other males. Modulations include the elimination of the ascending introductory note and the addition of airy, high frequency calls often referred to as “whisper calls” (Belinksky et al., 2015).

Veeries, like many thrushes, chorus at dawn and dusk (Belinksy et al., 2012). When compared to the dusk chorus, Belinsky et al. (2012) found that dawn chorusing Veeries experience increased interspecies acoustic competition. In their investigation, Veeries were often covered up by three species (Wood Thrush, Gray Catbird and Ovenbird) whose vocalizations share similar frequencies. Based on these findings, Belinsky et al. (2012) hypothesized that Veery dusk choruses evolved in response to acoustic competition. That is, in order to increase communication efficacy, it appears Veeries evolved to chorus at both dawn and dusk (Belinsky et al., 2012).

Veery foraging behavior mirrors that of other thrushes. Individuals can be found foraging on the ground or in low vegetation for insects, invertebrates and fruit. Veeries tend to search for hidden prey by lifting and flipping leaves with their beaks (Cornell Lab of Ornithology, 2015; Kaufman, 2014). Individuals may watch for prey from a low perch prior to dropping to the ground to forage or capture insects through short spurts of flight (Kaufman, 2014). 

  • Belinsky, K.L., Hogle, J.L., Schmidt, K.A. (2012). Veeries experience more varied acoustic competition at dawn than at dusk. The Wilson Journal of Ornithology, 124 (2), 265-269.
  • Belinsky, K.L., Nemes, C.E., Schmidt, K. (2015). Two novel vocalizations are used by Veeries (Catharus fuscescens) during agonistic interactions. Plos One 10 (3), 1-16.
  • Cornell Lab of Ornithology (2015). Veery (Catharus fuscescens). Retrieved from: http://www.allaboutbirds.org/guide/Veery/id
  • Kaufman, K. (2014). Veery. National Audubon Society: Guide to North American Birds. Retrieved October 6, 2015, from http://www.audubon.org/field-guide/bird/veery
  • Samuel, D.E. (1972). Song variation and other vocalizations of Veeries. Bird Banding, 43 (2) 118-127.
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Maria Dellapina, Haley Lloyd; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

During the breeding season, Veeries favor dense understory thickets containing low leafy vegetation. Preferred sites are typically in close proximity to water (Kaufman, 2014). As ground nesting birds, Veeries rarely place nests higher than five feet above ground. Female Veeries are the primary nest constructors (Kaufman, 2014), building mostly cup-shaped structures. Nests are typically constructed with grapevine bark, weed stems, and wet decomposed leaves. These structures are often built on top of herbaceous vegetation or tucked into brush and debris against fallen logs (Cornell Lab of Ornithology, 2015). The diameter of a Veery nest ranges from 3 to 6 inches. Nest height also exhibits variation, typically ranging between 3.5 to 5.5 inches (Cornell Lab of Ornithology, 2015).

Male Veeries initiate the breeding season by arriving first at breeding grounds. Upon reaching adequate habitat, males claim their territory prior to the arrival of the females. During this time, males are territorial with each other as well as exhibiting aggression toward arriving females. Males will display such aggressive behavior for about 3 to 4 days before transitioning into courtship displays. During courtship, male Veeries display a distinct combat dance among rival males by raising and snapping their bills, quivering their feet, freezing in an erect pose, and flickering their wings and tail (Cornell Lab of Ornithology, 2015).

The typical clutch size for a Veery is quite low at 1 to 5 eggs with females producing 1 to 2 broods a year. The incubation period lasts about 10 to 14 days and is then followed by a 10 to 20 nesting day period. Veery eggs are typically greenish blue in color and may rarely display brown spotting (Cornell Lab of Ornithology, 2015). Female Veeries primarily take on the responsibility of brooding after they have laid. Following hatching, feeding nestlings is a responsibility shared by both parents (Kaufman, 2014).  

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© Maria Dellapina, Haley Lloyd; Editors: Anneke DeLuycker, Jim McNeil, Marcy Heacker

Supplier: Anneke DeLuycker

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Eggs are laid in May-June. Clutch size is three to five (usually four). Incubation lasts 11-12 days, by female. Young are tended by both parents, leave nest at 10-12 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Catharus fuscescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.

Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.

See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTCTACCTAACTTTCGGCGCGTGGGCCGGAATAGTAGGCACCGCCCTAAGTCTTCTCATCCGAGCAGAACTGGGTCAACCAGGCGCACTACTAGGTGATGACCAGATCTACAACGTAGTTGTCACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCAATCATGATTGGGGGGTTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCACCATCATTCCTCCTCCTCTTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACCGTCTATCCTCCCCTTGCCGGCAACCTAGCACACGCAGGAGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGAATCTCCTCAATCCTAGGGGCCATCAACTTCATTACCACAGCTATCAACATAAAACCTCCCGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCAGTACTAATTACTGCAGTTTTACTCCTCCTCTCCCTTCCCGTCCTTGCTGCTGGCATCACCATACTCCTTACCGACCGTAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTTTACCAGCATCTATTCTGATTTTTCGGCCACCCCGAAGTGTATATCCTTATCCTG
-- end --

Download FASTA File

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catharus fuscescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • Least Concern (LC)
  • Least Concern (LC)
  • Least Concern (LC)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
  • Lower Risk/least concern (LR/lc)
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5