Articles on this page are available in 1 other language: Spanish (7) (learn more)

Overview

Brief Summary

Catharus fuscescens

Paler and less heavily-streaked than the other thrushes breeding in North America, the Veery (6 ½ - 7 ½ inches) is most easily identified by its tawny-colored back and head. Other field marks include pink legs, white breast, and dark eye lacking any noticeable eye-ring. Male and female Veerys are similar to one another in all seasons. The Veery breeds across southern Canada and the northern U.S.Smaller populations occur at higher elevations in the Rockies and the Appalachians south to New Mexico and Georgia, respectively. This species is a long-distance migrant, breeding in southeastern Brazil. In summer, Veerys breed in wet deciduous forests. On migration, this species may be found in the undergrowth of various kinds of forests across North America. Little is known about the Veery’s habitat preferences in winter due to the relative inaccessibility of its winter range, but all records for this species at that time of year come from dense tropical forests. Veerys eat fruits, berries, and insects during the breeding season; fruits are presumed to make up a large part of this species’ diet on winter grounds. The vast majority of North American birders, including many scientists, never see the Veery in its winter range. This species is much easier to observe in summer and on migration, although it is more often heard than seen due to its preference for habitats with thick vegetation. Veerys may be observed foraging food while hopping along the forest floor or through the branches of trees. Males may be located by listening for their unique, onomatopoeic song. The Veery is most active during the day, but, like many migratory songbirds, this species migrates at night.

Threat Status: Least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© Unknown

Supplier: DC Birds

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Range: (200,000-2,500,000 square km (about 80,000-1,000,000 square miles)) Nesting range extends from southern British Columbia across southern Canada to Nova Scotia and southwestern Newfoundland, south to central Oregon, Colorado, South Dakota, southern Great Lakes region, and New Jersey, and in the Appalachians to northern Georgia; also east-central Arizona and probably northern New Mexico (Moskoff 1995, AOU 1998).

Winter range may be restricted to three small areas in south-central and southeastern Brazil, at the periphery of or south of the Amazon basin (Remsen 2001). Formerly the species was thought to winter in South America from Guyana, northern Venezuela, and eastern Colombia to Amazonian Brazil and northern Bolivia (Cochabamba and Santa Cruz) (a few records from Peru and Chile) (Hilty and Brown 1986, Ridgely and Tudor 1989, Moskoff 1995).

Range extent score reflects nonbreeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Physical Description

Size

Length: 18 cm

Weight: 31 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Diagnostic Description

Differs from other thrushes in having less breast spotting (less distinct and more restricted). Differs from Pacific coast populations of Swainson's thrush (CATHARUS USTULATUS) in having gray (vs. buffy brown) flanks.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Ecology

Habitat

Comments: Nesting habitat includes swampy forest, especially in more open areas with shrubby understory, as well as second growth, willow or alder shrubbery near water; large tracts of forest are most suitable. Nests usually are on or near the ground, at the base of a shrub, in a clump of herbaceous vegetation, or in a shrub or low tree (Terres 1980). In migration and winter this species occurs also in lowland forest, woodland, and scrub.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Veery arrives in the southern U.S. in April, still common in migration mid-May, on northern nesting grounds by late April-early May (Terres 1980). Costa Rica: uncommon to sporadically common fall transient (late September-late October), rare spring transient (March-April) (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Trophic Strategy

Comments: Diet includes insects and other invertebrates and small fruits; foraging occurs on forest floors and in trees (Terres 1980), often near water (Stiles and Skutch 1989). This species eats many fruits during migration (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Associations

Known predators

Catharus fuscescens (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) is prey of:
Accipiter striatus
Accipiter cooperii
Bubo virginianus

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Known prey organisms

Catharus fuscescens (Baltimore oriole, chickadee, least flycatcher, rosebreasted grosbeak, willow thrush) preys on:
Araneae
Insecta

Based on studies in:
Canada: Manitoba (Forest)

This list may not be complete but is based on published studies.
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 410 (1930).
  • R. D. Bird, Biotic communities of the Aspen Parkland of central Canada, Ecology, 11:356-442, from p. 406 (1930).
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a very large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Total adult population size is unknown but presumably exceeds 1,000,000. Rich et al. (2004) estimated population size at 14,000,000.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 10.1 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Reproduction

Eggs are laid in May-June. Clutch size is three to five (usually four). Incubation lasts 11-12 days, by female. Young are tended by both parents, leave nest at 10-12 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Catharus fuscescens

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 14 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

NNCCTCTACCTAACTTTCGGCGCGTGGGCCGGAATAGTAGGCACCGCCCTAAGTCTTCTCATCCGAGCAGAACTGGGTCAACCAGGCGCACTACTAGGTGATGACCAGATCTACAACGTAGTTGTCACTGCTCATGCCTTCGTAATAATTTTCTTTATAGTCATGCCAATCATGATTGGGGGGTTCGGAAACTGACTAGTCCCCTTAATAATCGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTTCCACCATCATTCCTCCTCCTCTTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACCGTCTATCCTCCCCTTGCCGGCAACCTAGCACACGCAGGAGCCTCAGTAGACCTGGCTATCTTCTCCCTCCACCTAGCAGGAATCTCCTCAATCCTAGGGGCCATCAACTTCATTACCACAGCTATCAACATAAAACCTCCCGCCCTATCACAATACCAAACCCCCCTATTCGTATGATCAGTACTAATTACTGCAGTTTTACTCCTCCTCTCCCTTCCCGTCCTTGCTGCTGGCATCACCATACTCCTTACCGACCGTAACCTAAACACCACCTTCTTCGACCCAGCAGGAGGAGGAGACCCAGTACTTTACCAGCATCTATTCTGATTTTTCGGCCACCCCGAAGTGTATATCCTTATCCTG
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Statistics of barcoding coverage: Catharus fuscescens

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 14
Specimens with Barcodes: 16
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Conservation

Conservation Status

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5B - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Large nesting range in North America; small winter range in Brazil; overall, population evidently is large but undergoing a steady decline, possibly due to habitat loss in wintering and breeding areas. Ranks needs further review; NatureServe rank calculator version 6.2 yielded a rank of G4.

Intrinsic Vulnerability: Not intrinsically vulnerable

Environmental Specificity: Moderate. Generalist or community with some key requirements scarce.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Short Term Trend: Decline of 10-30%

Comments: North American Breeding Bird Survey (BBS) data indicate a significant annual population decline of 1.9 percent for the period 1980-2007. This rate of decline translates to an estimated loss of 17 percent of the population over a 10-year period.

Global Long Term Trend: Decline of 30-50%

Comments: Long-term trend (last 200 years) is uncertain. North American Breeding Bird Survey (BBS) data indicate a significant annual population decline of 1.5 percent for the period 1966-2007 (decline from average of 5-6 birds per route to 3-4 birds per route). This rate of decline translates to an estimated loss of 46 percent of the population.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Population

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Threats

Degree of Threat: High

Comments: Declines presumably are due to loss of habitat, both on the breeding and wintering ranges. The fact that the winter range is likely restricted to three small areas in Brazil where habitat loss is occurring is of great concern (Remsen 2001). In the nesting range, forest fragmentation may lead to increased parasitism by brown-headed cowbird (Bevier et al. 2005), but the population impact of this needs further study. Increased browsing of forest understory vegetation by growing populations of white-tailed deer may be a threat to nesting habitat, but this needs confirmation (Bevier et al. 2005).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Management

Preserve Selection and Design Considerations: Classified as area sensitive (i.e., occurs more frequently or at higher population density as forest size increases) by Freemark and Collins (1992), but other data on area-sensitivity inconsistent (see Askins et al. 1987, Robbins et al. 1989, Blake 1991). In Illinois, nesting occurred in forest patches of 27-1000+ ha; only two of 22 patches were smaller than 100 ha; mean patch size was 309 ha; patches used for nesting tended to be surrounded by other forested habitat (Herkert 1995). In Wisconsin, nesting was much more likely in forest patches larger than 100 ha than in smaller patches (Temple, cited by Herkert 1995). Robbins et al. (1989) found that nesting in the mid-Atlantic states was most likely in forest patches of 3000 ha or larger but breeding sometimes occurred in patches as small as nine ha. Associated with large (> 8 ha) aspen groves in Saskatchewan (Johns 1993).

Management Requirements: Litwin and Smith (1992): nesting population in Sapsucker Woods, Ithaca, NY declined 58% from 1950-1980, correlated with maturation of forest, decline in density of shrub layers and decline in overall vertical and horizontal structural heterogeneity; implies that some disturbance may be necessary to maintain suitable nesting habitat.

Benefits from logging (Maurer et al. 1981, Webb et al. 1977).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: Many occurrences are in protected areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Wikipedia

Veery

The veery (Catharus fuscescens) is a small North American thrush species, a member of a group of closely related and similar species in the genus Catharus, also including the gray-cheeked thrush (C. minimus) and Bicknell's thrush (C. bicknelli).[2]

Juvenile, banded near Montreal, Canada

Description[edit]

This species measures 16–19.5 cm (6.3–7.7 in) in length. Its mass is 26–39 g (0.92–1.38 oz), exceptionally up to 54 g (1.9 oz). The wingspan averages 28.5 cm (11.2 in).[3] Each wing measures 8.9–10.4 cm (3.5–4.1 in), the bill measures 1.2–1.9 cm (0.47–0.75 in) and the tarsus is 2.7–3.25 cm (1.06–1.28 in).[4] The veery shows the characteristic underwing stripe of Catharus thrushes. Adults are mainly light brown on the upperparts. The underparts are white; the breast is light tawny with faint brownish spots. Veeries have pink legs and a poorly defined eye ring. Birds in the eastern portions of the species' breeding range are more cinnamon on the upperparts; western birds are more olive-brown. In the east, the veery is distinguished easily by its coloration; distinguishing western veeries from other Catharus thrushes is more difficult.[5]


Problems playing this file? See media help.

This bird has a breezy, downward-spiralling, flute-like song, often given from a low and concealed perch. The most common call is a harsh, descending vee-er, which gave the bird its name.

Ecology[edit]

The breeding habitat is humid deciduous forest across southern Canada and the northern United States. These birds migrate to eastern South America. They are very rare vagrants to western Europe.

They forage on the forest floor, flipping leaves to uncover insects; they may fly up to catch insects in flight. They mainly eat insects and berries.

They make a cup nest on the ground or near the base of a shrub. This bird has been displaced in some parts of its range by the related wood thrush (Hylocichla mustelina). Veeries are occasional hosts for the eggs of brown-headed cowbirds (Molothrus ater).

Footnotes[edit]

  1. ^ BirdLife International (2012). "Catharus fuscescens". IUCN Red List of Threatened Species. Version 2013.2. International Union for Conservation of Nature. Retrieved 26 November 2013. 
  2. ^ Winker & Pruett (2006)
  3. ^ [1]
  4. ^ Thrushes by Peter Clement. Princeton University Press (2001), ISBN 978-0691088525
  5. ^ [2]

References[edit]

  • Winker, Kevin & Pruett, Christin L. (2006): Seasonal migration, speciation, and morphological convergence in the avian genus Catharus (Turdidae). Auk 123(4): 1052-1068. [Article in English with Spanish abstract] DOI: 10.1642/0004-8038(2006)123[1052:SMSAMC]2.0.CO;2 PDF fulltext
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Default rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Formerly placed in genus HYLOCICHLA (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Default rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!