Overview

Distribution

Geographic Range

Hermit thrushes (Catharus guttatus) are widely distributed songbirds found in northern hardwood forests and boreal and mountainous coniferous forests throughout North America during the breeding season, and both North America and Central America during the winter. In North America, they breed in the western and northeastern United States into Alaska and much of the southern half of Canada. The winter northern boundary is in the United States from southern Massachusetts moving gradually southwest to the southern parts of Ohio, Indiana, Illinois, Arkansas, most of Oklahoma and Texas. Their winter range then encompasses all of the area below this to the Gulf of Mexico and then south through Mexico to Oaxaca. They are found year round in much of New Mexico and in the eastern half of Arizona. Within these broad ranges individuals are short-distance migrants. They do not cross the Gulf of Mexico as other Catharus species do. They are found in lower altitudes, river valleys and coastal areas in these wintering areas.

There are currently 8 recognized subspecies of hermit thrushes divided into 3 geographic groups including 3 subspecies in the Pacific coastal group, 3 subspecies in the northwestern interior mountains group, and 2 subspecies in the eastern group.

Biogeographic Regions: nearctic (Native ); neotropical (Native )

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders Handbook: a Field Guide to the Natural History of North American Birds. New York, New York: Simon and Schuster Inc..
  • Jones, P., T. Donovan. 1996. Hermit Thrush (Catharus guttatus). Pp. 1-28 in A Poole, F Bill, eds. The Birds of North America. Philadelphia and Washington D.C.: Academy of Natural Sciences and American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

Canada

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Breeding

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: (>2,500,000 square km (greater than 1,000,000 square miles)) Breeding range extends from western and central Alaska across southern Mackenzie to southern Labrador and Newfoundland, south to southern Alaska, in the mountains to southern and eastern California, southern Nevada, central and southeastern Arizona, southern New Mexico, and western Texas; east of the Rockies to southwestern and central Alberta, central Saskatchewan, northern Minnesota, northeastern Ohio, western Virginia, western Maryland, southern New Jersey, and southern New York; also isolated breeding population in Black Hills, South Dakota (AOU 1998). Breeding also occurs in the Sierra San Pedro Martir, Baja California (Erickson and Wurster 1998). Nonbreeding range extends from southern British Columbia, northern U.S., southern Ontario and New England, south to southern Baja California, through Mexico to Guatemala and El Salvador, southern Texas, Gulf Coast, southern Florida, and the northern Bahamas (AOU 1998).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Morphology

Physical Description

Hermit thrushes are shorter and stockier than other spotted thrushes, with an average length of 6.75 in (17.2 cm) and wingspan of 11.5 in (29.2 cm). The three main geographic groups have graded characteristics, with a distinct white eye-ring, indistinct whitish bar over the lores, darkly spotted breast and sides of the throat, olive-brown to gray-brown dorsal coloration, white ventral side with buffy to grayish flanks, and varying amount of reddish wash on flight feathers and tail. There is no obvious sexual dimorphism in this thrush species.

Hermit thrushes have reddish coloration on the tail, whereas wood thrushes (Hylocichla mustelina) have similar coloration on the head and veery (Catharus fuscescens) have reddish upper parts. Gray-cheeked (Catharus minimus) and Bicknell's (Catharus bicknelli) thrushes also have some reddish coloration, but they only have a thin partial eye-ring and do not have the whitish bar over the lores. Because hermit thrushes are short-distance migrants, their primary flight feathers do not project beyond their secondaries. Other thrushes that migrate over longer distances have longer primary projections, including the Swainson's thrush (Catharus ustulatus) and grey-cheeked thrush (Catharus minimus).

Average length: 17.2 cm.

Average wingspan: 29.2 cm.

Other Physical Features: endothermic ; homoiothermic; bilateral symmetry

Sexual Dimorphism: sexes alike

Average mass: 27.8 g.

  • Sibley, D. 2000. National Audubon Society: The Sibley Guide to Birds. New York: Chanticleer Press, Inc..
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Size

Length: 17 cm

Weight: 31 grams

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Habitat

Hermit thrushes use a wide range of forest vegetation types. Breeding habitat includes young to climax forest vegetation types with internal forest edges. These birds are found in the interior of such forest vegetation types near openings including ponds, meadows, or small man-made clearings.

During winter in the United States, hermit thrushes are usually found at lower elevations than that of their summer habitat. Characteristics of winter habitat include a dense cover of woody plants proximate to insect populations and berry-bearing vegetation. Hermit thrushes need open water in their winter habitat. Information on habitat in Mexico is limited, and no generalizations can be made.

Habitat Regions: temperate ; terrestrial

Terrestrial Biomes: forest ; scrub forest

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open humid coniferous and mixed forest and forest edge, dry sandy and sparse jackpine, less frequently in deciduous forest and thickets; in migration and winter also chaparral, riparian woodland, arid pine-oak, desert scrub. Negatively impacted by forest fragmentation in southern Wyoming (Keller and Anderson 1992). Associated with large (>24 ha) aspen groves in Saskatchewan (Johns 1993). Nests usually on ground under conifer with low branches or hidden by low plants, or in low conifer or other tree or bush within 3 m of ground.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: No. All populations of this species make significant seasonal migrations.

Locally Migrant: Yes. At least some populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: Yes. At least some populations of this species make annual migrations of over 200 km.

Long-distance migrant throughout Canada and most of U.S. breeding range.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Food Habits

Hermit thrushes are omnivores that eats insects, small invertebrates, and fruits from trees, shrubs, and herbaceous plants. They forage on both the ground and in vegetation, and may move leaf litter with their bills to look for food, glean from leaves while perched or after hovering, or probe into ground or dead wood. The proportion of animal and vegetable content in the diet of Hermit Thrushes varies with availability. Generally, hermit thrushes consume more animal matter during the spring and summer, and more vegetable matter (especially berries) in the fall and winter.

Foods commonly eaten include: beetles, bees, ants, wasps, flies, true bugs, other small invertebrates, small amphibians and reptiles, and fruits.

Animal Foods: amphibians; reptiles; insects; terrestrial non-insect arthropods; terrestrial worms

Plant Foods: fruit

Primary Diet: omnivore

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Eats insects and other invertebrates mostly from ground; also eats small fruits (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Associations

Ecosystem Roles

Commensal/Parasitic Species:

  • ticks (Ixodides)
  • lice (Pthiraptera)
  • louse flies (Hipposboscidae)
  • mites (Acari)
  • spirochaetes

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Predation

There is little information on predation but they probably are subject to the usual songbird nest predators (snakes, crows, jays, raccoons). Body parasites found on or in adult hermit thrushes include lice, louse flies, mites, spirochetes and ticks.

Known Predators:

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known predators

Catharus guttatus is prey of:
Serpentes
Cyanocitta cristata
Corvus brachyrhynchos
Procyon lotor

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Known prey organisms

Catharus guttatus preys on:
Insecta
Amphibia
Reptilia

This list may not be complete but is based on published studies.
Creative Commons Attribution 3.0 (CC BY 3.0)

© SPIRE project

Source: SPIRE

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population Biology

Number of Occurrences

Note: For many non-migratory species, occurrences are roughly equivalent to populations.

Estimated Number of Occurrences: > 300

Comments: This species is represented by a large number of occurrences (subpopulations).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Abundance

>1,000,000 individuals

Comments: Global population estimate is 56,000,000 birds (Rich et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan/Longevity

A banded hermit thrush lived at least 8 years and 8 months. Other thrushes have been known to live 10 to 13 years.

Range lifespan

Status: wild:
8.55 (high) years.

Average lifespan

Status: wild:
112 months.

  • USGS Patuxent Wildlife Research Center, 2002. "Longevity records of North American birds" (On-line). Accessed 30 July 2002 at http://www.pwrc.usgs.gov/bbl/homepage/longvrec.htm.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Lifespan, longevity, and ageing

Maximum longevity: 9.3 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Reproduction

Males establish and defend breeding territories in late April to late May. Once a female is accepted into a male's territory, she begins building a nest. The open-cup nest is 10 to 15 cm in diameter and consists of a variety of vegetable material including grass, leaves, mosses, and lichens. Nest location is variable. In the eastern United States nests found on the ground beneath live woody and non-woody plants and in open areas, and in the western United States nests were commonly located above the ground. Females lay 3 to 6 eggs beginning in Late May, and may lay 2nd or 3rd brood as late as August. Egg color ranges from very pale blue to blue-green with few brown flecks. Females begin incubating after final egg is laid, and this period lasts around 12 days. The male feeds the female during incubation.

A hatching bird "pips" the egg, breaks its shell into 2 parts near the egg's greatest diameter. The female removes eggshells from the nest after young hatch. Young are altricial at hatching and have minimal dark grayish down on crown and dorsal feather tracts. The female feeds nestlings with food brought to the nest by the male. Nestling eyes are open by the 3rd day after hatching; full juvenile plumage develops by 10 to 12 days after hatching. Nestlings fledge 10 to 15 days after hatching by leaping from the nest towards a parent on the ground. No information on development from fledging through immature stages is available.

Brood parasitism by the brown-headed cowbird is common, but little is known on how this affects populations of the Hermit Thrush. Recruitment may be limited by nest predation, but little information is available. Studies estimating the probability of fledging at least 1 nestling varied from 17% in Arizona to 37% East of the Rocky Mountains. There is no evidence of cooperative breeding in hermit thrushes.

Breeding interval: These birds once per year, in the spring and summer.

Breeding season: May through August

Range eggs per season: 3 to 6.

Average time to hatching: 12 days.

Range fledging age: 10 to 15 days.

Key Reproductive Features: seasonal breeding ; gonochoric/gonochoristic/dioecious (sexes separate); fertilization (External )

Average time to hatching: 12 days.

Average eggs per season: 3.

Females incubate and deliver food to the nestlings. Males bring food to the nest.

Parental Investment: altricial ; pre-fertilization (Provisioning); pre-hatching/birth (Provisioning: Female, Protecting: Male, Female); pre-weaning/fledging (Provisioning: Male, Female, Protecting: Male, Female); pre-independence (Provisioning: Male, Female, Protecting: Male, Female)

  • Ehrlich, P., D. Dobkin, D. Wheye. 1988. The Birders Handbook: a Field Guide to the Natural History of North American Birds. New York, New York: Simon and Schuster Inc..
  • Jones, P., T. Donovan. 1996. Hermit Thrush (Catharus guttatus). Pp. 1-28 in A Poole, F Bill, eds. The Birds of North America. Philadelphia and Washington D.C.: Academy of Natural Sciences and American Ornithologists' Union.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Clutch size usually is 3-4. Incubation, by female, lasts 12-13 days. Young are tended by both parents, leave nest at 10-12 days.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Evolution and Systematics

Functional Adaptations

Functional adaptation

Dietary choices fight oxidative stress: migratory songbirds
 

Migratory songbirds prepare for long flights by eating berries rich in antioxidants.

   
 

"Bug-chomping songbirds have been discovered doing something  remarkable before migrating south for the winter: They switch,  awkwardly, to berries rich in antioxidants.

 

"The dietary change has less to do with fattening up and more to do  with stocking up on nutrients to help their bodies deal with the stresses of migration, say researchers." (O'Hanlon 2010)


  Learn more about this functional adaptation.
  • O'Hanlon L. 2010. Birds fuel up on super foods before migrating. Discovery News [Internet],
Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© The Biomimicry Institute

Source: AskNature

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Catharus guttatus

The following is a representative barcode sequence, the centroid of all available sequences for this species. 

 
There are 34 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.
 
GBIR710-08|EF484235|Catharus guttatus| AACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTCTACCTAATCTTCGGCGCATGGGCCGGAATAGTGGGTACTGCCCTA---AGCCTTCTCATCCGAGCAGAACTAGGTCAACCAGGAGCGCTACTAGGCGAC---GACCAAATCTACAATGTAGTTGTCACCGCTCATGCATTCGTAATAATTTTCTTTATAGTCATGCCGATCATGATCGGGGGATTCGGAAACTGACTAGTCCCCTTAATG---ATTGGAGCCCCAGACATAGCATTCCCTCGAATAAACAACATAAGCTTCTGACTTCTCCCACCATCATTCCTCCTCCTCTTAGCCTCCTCCACAGTAGAAGCAGGAGCAGGAACAGGATGAACCGTCTACCCTCCCCTCGCTGGCAATCTAGCACACGCAGGAGCTTCAGTAGACCTA---GCTATCTTCTCTCTTCACTTAGCAGGAATCTCCTCAATCCTAGGAGCCATCAACTTCATTACCACAGCAATCAACATAAAACCCCCTGCCCTTTCACAATACCAAACCCCCCTGTTCGTATGATCAGTGTTAATCACTGCAGTTTTACTCCTCCTCTCCCTCCCCGTCCTAGCTGCT---GGCATCACTATACTCCTCACTGACCGCAATTTAAATACCACCTTCTTCGACCCAGCAGGGGGAGGAGACCCAGTACTTTACCAGCATCTATTCTGATTTTTCGGCCACCCCGAAGTGTATATCCTCATCCTCCCAGGATTTGGTATTATCTCTCACGTCGTAGCCTACTATGCAGGAAAAAAG---GAACCTTTCGGTTACATAGGAATGGTATGAGCCATACTATCTATCGGCTTCCTTGGGTTCATCGTATGAGCCCACCACATATTCACGGTAGGCATGG  
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Catharus guttatus

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 33
Species: 35
Species With Barcodes: 1

Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation Status

Breeding Bird Surveys indicate that hermit thrush populations have increased over extensive parts of their range.

US Migratory Bird Act: protected

US Federal List: no special status

CITES: no special status

State of Michigan List: no special status

IUCN Red List of Threatened Species: least concern

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

Canada

Rounded National Status Rank: N5B - Secure

United States

Rounded National Status Rank: N5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Reasons: Widespread, abundant, and secure.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Short Term Trend: Relatively stable to increase of 25%

Global Long Term Trend: Relatively stable to increase of >25%

Comments: Breeding Bird Survey (BBS) data indicate a positive population trend throughout much of the range since 1966, possibly as a result of expansion of suitable habitat from woodland cutting (Jones and Donovan 1996). For the period 1980-2005, BBS data indicate a positive survey-wide trend of 0.8% per year (P<0.01, n = 1086; Sauer et al. 2005). Christmas Bird Count (CBC) surveys also show a survey-wide increase of 2.2% per year for the period 1965-2002 (Niven et al. 2004).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Threats

Comments: Potential threats include human-caused and natural habitat alteration or loss, effects of human intrusion, and natural causes of mortality such as predation and severe weather events. However, on a range-wide scale, this species is not significantly threatened.

Changes in abundance have been noted in response to various tree removal practices. Some researchers suggest that Hermit Thrush populations are equally stable on both logged and unlogged habitats (Webb et al. 1977, Medin 1985) and that density and productivity are higher in younger stands (Rangen et al. 2000). Others suggest that breeding densities are higher in unlogged habitats (Franzreb and Ohmart 1978, Medin and Booth 1989, Jones and Donovan 1996, Hanowski et al. 2003).

Hermit Thrush densities have decreased following wildfires. Declines resulted both immediately (Apfelbaum and Haney 1981) and several years post- burn (8 years later; see sources in Jones and Donovan 1996).

Habitat fragmentation and the resultant increase in edge habitats may negatively affect nesting success due to increased predator abundance and activity along edges (Manolis et al. 2002). Hames (1999) reported that as forest habitat fragmentation increased, nesting attempts decreased throughout the species' North American range.

Martin and Roper (1988, in Jones and Donovan 1996) suggested that disturbance by researchers did not impact thrush nesting behavior or success in Arizona, but Gutzwiller and Anderson (1999) reported that low levels of human intrusion increased displacement of thrushes and resulted in lower abundance than prior to intrusion events in the Snowy Mountains, Wyoming.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Management

Biological Research Needs: Research needed on breeding biology, including estimation of adult and juvenile survival and nest success in different habitats; basic nesting information such as number of broods, offspring and nest attempts per year; fidelity to natal, breeding, and wintering sites; and determination of subspecies validity using studies of geographic dispersal and genetic or morphological characteristics (Jones and Donovan 1996). However, effective conservation of this species does not depend on this research.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Protection: Very many (>40) occurrences appropriately protected and managed

Comments: This species occurs in many protected area such as national parks and wilderness areas.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Relevance to Humans and Ecosystems

Benefits

Economic Importance for Humans: Negative

There are no known adverse effects of Hermit Thrushes on humans.

Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© The Regents of the University of Michigan and its licensors

Source: Animal Diversity Web

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Hermit Thrush

The Hermit Thrush (Catharus guttatus) is a medium-sized North American thrush. It is not very closely related to the other North American migrant species of Catharus, but rather to the Mexican Russet Nightingale-thrush.[1]

Contents

Description

This species is 15–17 cm in length, and has the white-dark-white underwing pattern characteristic of Catharus thrushes. Adults are mainly brown on the upperparts, with reddish tails. The underparts are white with dark spots on the breast and grey or brownish flanks. They have pink legs and a white eye ring. Birds in the east are more olive-brown on the upperparts; western birds are more grey-brown.

Behaviour

Taken in southern Ontario during winter

Their breeding habitat is coniferous or mixed woods across Canada, Alaska, and the northeastern and western United States. They make a cup nest on the ground or relatively low in a tree.

Hermit Thrushes migrate to wintering grounds in the southern United States and south to Central America but some remain in northern coastal US states and southern Ontario.[2] Although they usually only breed in forests, Hermit Thrushes will sometimes winter in parks and wooded suburban neighbourhoods. They are very rare vagrants to western Europe. It has also occurred as a vagrant in northeast Asia.[3]

They forage on the forest floor, also in trees or shrubs, mainly eating insects and berries.

Song

The Hermit Thrush's song[4] is ethereal and flute-like, consisting of a beginning note, then several descending musical phrases in a minor key, repeated at different pitches. They often sing from a high open location.

In culture

Ocala National Forest, Florida 2008

The Hermit Thrush is the state bird of Vermont.

Walt Whitman construes the Hermit Thrush as a symbol of the American voice, poetic and otherwise, in his elegy for Abraham Lincoln, "When Lilacs Last in the Dooryard Bloom'd,"[5] one of the fundamental texts in the American literary canon. "A Hermit Thrush"[6] is the name of a poem by the American poet Amy Clampitt. A Hermit Thrush appears in the fifth section ("What the Thunder Said") of the T. S. Eliot poem The Waste Land.

Former Canadian indie-rock band Thrush Hermit took their name from a reversal of the two parts. It is also shared by the American bands Hermit Thrushes and Hermit Thrush.

The song of the Hermit Thrush is audible in the "Garden" stage of Super Mario Galaxy for the Nintendo Wii.

References

  1. ^ Winker & Pruett, 2006
  2. ^ Hermiut Thrush, All about Birds
  3. ^ Brazil, Mark (2009) Birds of East Asia ISBN 978-0-7136-7040-0 page 402
  4. ^ "Hermit Thrush Song" (WAV). Archived from the original on 2007-10-31. http://web.archive.org/web/20071031084720/http://www.geocities.com/birdwatchernj/birdsongs/thrush_hermit_837.wav. Retrieved 2008-07-26.  (Through The Internet Archive)
  5. ^ Whitman, Walt. "When Lilacs Last in the Door-yard Bloom’d". Bartleby. http://www.bartleby.com/142/192.html. Retrieved 2008-07-26. 
  6. ^ Clampitt, Amy. "A Hermit Thrush". The Academy of American Poets. http://www.poets.org/viewmedia.php/prmMID/15322. Retrieved 2008-07-26. 

Works cited

  • BirdLife International (2004). Catharus guttatus. 2006. IUCN Red List of Threatened Species. IUCN 2006. www.iucnredlist.org. Retrieved on 12 May 2006. Database entry includes justification for why this species is of least concern
  • Winker, Kevin & Pruett, Christin L. (2006): Seasonal migration, speciation, and morphological convergence in the avian genus Catharus (Turdidae). Auk 123(4): 1052-1068. [Article in English with Spanish abstract] DOI: 10.1642/0004-8038(2006)123[1052:SMSAMC]2.0.CO;2 PDF fulltext
  • Farrand, John & Bull, John, The Audubon Society Field Guide to North American Birds, Eastern Region, National Audubon Society (1977)
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: This species formerly was placed in genus Hylocichla (AOU 1983). Systematics are complex and have little consensus. Several subspecies are recognized by various authors. The American Ornithologists' Union (1957) and Ripley (1964) recognized eight subspecies, Aldrich (1968) recognized 10 subspecies, and Phillips (1991) recognized 13 (see Jones and Donovan 1996). Subspecies vary morphologically, especially in wing, tail, and tarsus length, and plumage coloration; bill length increases from north to south of range, tarsus length decreases from north to south (Aldrich 1968). Three generally recognizable groups include birds occurring east of the Rocky Mountains, central Alaska south through the Sierra Nevada and Rocky Mountains, and west and north of the Sierra Nevada-Cascade ranges along the Pacific coast (Lane and Jaramillo 2000).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!