Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
  • Freshwater
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.8 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Statistics of barcoding coverage: Dendrocopos minor

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 8
Specimens with Barcodes: 9
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Barcode data: Dendrocopos minor

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 8 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CCTTATCTTCGGGGCATGAGCCGGCATAATCGGCACAGCCCTTAGCCTACTCATCCGAGCAGAGCTAGGCCAACCCGGTACCCTCCTCGGCGACGACCAAATTTACAATGTCATTGTTACTGCCCATGCATTCGTAATAATCTTCTTCATAGTAATACCCATCATAATCGGAGGATTCGGAAACTGACTTGTACCACTCATAATCGGAGCCCCCGACATAGCATTCCCACGAATAAACAACATAAGCTTTTGACTCCTCCCCCCATCATTCCTTCTCCTCCTAGCCTCCTCCACAGTAGAAGCAGGAGCCGGAACAGGATGAACCGTTTATCCCCCCCTTGCCGGCAACTTAGCCCACGCAGGGGCCTCAGTAGACCTAGCCATTTTCTCACTCCATTTGGCTGGTATCTCATCAATCCTGGGAGCAATCAACTTCATCACAACAGCCATCAACATAAAACCCCCGGCCATTTCACAATATCAAACCCCCCTATTCGTCTGATCCGTCCTTATCACCGCTGTCCTCCTACTCCTATCACTTCCCGTACTCGCCGCTGGCATCACAATACTCCTCACAGATCGCAACCTAAACACCACATTCTTCGACCCCGCTGGGGGAGGGGACCCCATCCTCTACCAACATCTCTTCTGATTCTTTGGTCACCCTGAAGTCTACATCCTGATTCTTCCAGGATTTGGAATTATCTCCCACGTA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2012

Assessor/s
BirdLife International

Reviewer/s
Butchart, S. & Symes, A.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). Despite the fact that the population trend appears to be decreasing, the decline is not believed to be sufficiently rapid to approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Population

Population
In Europe, the breeding population is estimated to number 450,000-1,100,000 breeding pairs, equating to 1,350,000-3,300,000 individuals (BirdLife International 2004). Europe forms 25-49% of the global range, so a very preliminary estimate of the global population size is 2,760,000-13,200,000 individuals, although further validation of this estimate is needed. National population estimates include: c.100-10,000 breeding pairs in China; < c.100 breeding pairs in Korea; < c.100 breeding pairs in Japan and c.100-10,000 breeding pairs in Russia (Brazil 2009).

Population Trend
Decreasing
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Lesser Spotted Woodpecker

The Lesser Spotted Woodpecker (Picoides minor) is a member of the woodpecker family Picidae. It is sometimes assigned to the genus Dendrocopos (sometimes incorrectly spelt as Dendrocopus).

The range of the Lesser Spotted Woodpecker is the Palearctic region, but several subspecies are recognised.

Description[edit]

From its small size and its habit of spending most of its time in the tops of tall trees in woods and parks, this little woodpecker is often overlooked, but if sighted on a trunk it may at once be identified by the broad barring on the wings and narrower bars across the lower back.

The male has a crimson crown, a brown forehead, a black superciliary stripe, and another from the base of the bill to the neck. The nape and upper back are black, but the lower back is barred with black and white. On the wings are broader and more conspicuous bars, and the outer tail feathers are also barred. The under parts are white with streaks on the flanks. The bill and legs are slate-grey.

In the female the crown is white, but the young birds of both sexes have more or less crimson on the head. There are no marked seasonal changes.

Ecology[edit]

Frontal view

Its habits are very similar to those of the Great Spotted Woodpecker, and it has the same stumpy appearance, almost triangular, when bounding from tree to tree. Its note is a repeated "keek", loud for so small a bird, and its vibrating rattle can with experience be distinguished from that of the larger species. This substitute for a song may be heard at all times, but most frequently when courtship begins early in the year.

Its insect food is similar to that of the Great Spotted Woodpecker. When hunting for wood-boring larvae it chips away at the rotten wood, and the litter at the foot of a tree is often the first indication that insects are attacking upper branches. From autumn to spring it hunts mainly on wood-living insect larvae, frequently from thin dead branches in living trees. Through the breeding season, surface-living insects from the foliage and bark of trees make up an increased amount of the diet. Nestlings are mainly fed with surface-living insects, such as aphids and larval insects. At night it roosts in old holes.

A litter of chips is also a guide to a nesting hole, for the bird does not always carry these away when excavating. The hole is usually at a considerable height above the ground and may be as high as 30 or 40 feet, 10 or 20 meters. It is a smaller burrow than that of the Great Spotted Woodpecker, measuring from 1 to 2 inches, 2.5 to 5 cm in diameter.

The shaft varies, the nesting cavity being often a foot or more below the entrance. Five to eight highly polished white eggs are laid upon wood dust and chips in the latter half of May, and a single brood is the rule. Both birds help to incubate. Occasionally an old or natural hollow is used or enlarged.

Populations of Lesser Spotted Woodpeckers are mostly resident, but can be nomadic to some degree. Annual fluctuations in population numbers are common. The winter temperatures may have a direct effect on winter survival of Lesser Spotted Woodpeckers by heat loss, whereas weather conditions during spring have an indirect effect on breeding performance by affecting food sources.

References[edit]

  • Gorman, Gerard (2004): Woodpeckers of Europe: A Study of the European Picidae. Bruce Coleman, UK. ISBN 1-872842-05-4.
  • Steen R., Selås V. & Stenberg I. 2006. Impact of weather on annual fluctuations in breeding numbers of Lesser Spotted Woodpecker Dendrocopos minor in Norway. Ardea 94(2): 225–231. (download article [1])
Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!