Articles on this page are available in 1 other language: Spanish (9) (learn more)

Overview

Distribution

occurs (regularly, as a native taxon) in multiple nations

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National Distribution

United States

Origin: Native

Regularity: Regularly occurring

Currently: Present

Confidence: Confident

Type of Residency: Year-round

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Global Range: RESIDENT: from Guerrero, state of Mexico, Hidalgo, eastern San Luis Potosi, central Nuevo Leon, and southern Tamaulipas south along both slopes of Middle America to northern Colombia. Casual in southern Texas (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Physical Description

Size

Length: 23 cm

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Ecology

Habitat

Habitat and Ecology

Systems
  • Terrestrial
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Comments: Open woodland, clearings, second growth, plantations, and gardens (AOU 1983). Outside breeding season penetrates well into heavy forest, canebrakes, and dense second growth to forage, but nests in more open surroundings (Stiles and Skutch 1989). BREEDING: Nests in dense cover of tree or small bush, usually 1-4 m above ground (up to 30 m), in yards, plantations, shady pastures, hedges (Terres 1980).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Migration

Non-Migrant: Yes. At least some populations of this species do not make significant seasonal migrations. Juvenile dispersal is not considered a migration.

Locally Migrant: No. No populations of this species make local extended movements (generally less than 200 km) at particular times of the year (e.g., to breeding or wintering grounds, to hibernation sites).

Locally Migrant: No. No populations of this species make annual migrations of over 200 km.

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Trophic Strategy

Comments: Eats invertebrates obtained from ground, also fruits (Terres 1980); earthworms, slugs, larval and adult insects, an occasional lizard, fruits of many kinds, readily attracted to feeders (Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Life History and Behavior

Life Expectancy

Lifespan, longevity, and ageing

Maximum longevity: 9.6 years (wild)
Creative Commons Attribution 3.0 (CC BY 3.0)

© Joao Pedro de Magalhaes

Source: AnAge

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Reproduction

Breeds mainly in dry season in central Panama (Hilty and Brown 1986). Clutch size 2-4 (usually 203). Incubation about 12 days. Sometimes 2 broods (Costa Rica, Stiles and Skutch 1989).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Molecular Biology and Genetics

Molecular Biology

Barcode data: Turdus grayi

The following is a representative barcode sequence, the centroid of all available sequences for this species.


There are 5 barcode sequences available from BOLD and GenBank.  Below is a sequence of the barcode region Cytochrome oxidase subunit 1 (COI or COX1) from a member of the species.  See the BOLD taxonomy browser for more complete information about this specimen and other sequences.

CTCTATCTAATCTTCGGCGCATGAGCCGGAATAGTGGGTACTGCCCTAAGTCTCCTCATCCGAGCAGAACTAGGCCAACCAGGTGCCCTACTAGGCGACGACCAAATCTACAACGTAGTCGTTACCGCCCATGCTTTCGTAATAATCTTCTTCATAGTTATACCAATCATAATCGGAGGGTTCGGAAATTGACTAGTCCCCCTAATAATCGGAGCCCCAGACATAGCATTCCCCCGAATAAACAACATAAGCTTTTGACTCCTCCCCCCATCCTTCCTTCTCCTCCTAGCCTCTTCTACAGTAGAAGCTGGGGCAGGAACAGGCTGAACCGTCTATCCTCCCCTCGCCGGCAACCTAGCACACGCGGGAGCTTCAGTTGACCTAGCCATCTTTTCCCTACACCTAGCAGGAATCTCCTCAATCCTAGGGGCCATCAACTTCATCACAACAGCAATCAACATAAAACCACCTGCCCTTTCACAATACCAAACCCCCCTATTCGTCTGATCAGTCCTGATCACTGCAGTGCTACTCCTACTATCCCTCCCCGTCCTTGCCGCTGGCATCACTATACTCCTCACCGATCGCAACCTAAACACGACCTTCTTCGACCCAGCAGGAGGGGGAGATCCAGTACTATACCAGCACCTCTTCTGA
-- end --

Download FASTA File
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Statistics of barcoding coverage: Turdus grayi

Barcode of Life Data Systems (BOLDS) Stats
Public Records: 2
Specimens with Barcodes: 17
Species With Barcodes: 1
Creative Commons Attribution 3.0 (CC BY 3.0)

© Barcode of Life Data Systems

Source: Barcode of Life Data Systems (BOLD)

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Conservation

Conservation Status

IUCN Red List Assessment


Red List Category
LC
Least Concern

Red List Criteria

Version
3.1

Year Assessed
2009

Assessor/s
BirdLife International

Reviewer/s
Bird, J., Butchart, S.

Contributor/s

Justification
This species has an extremely large range, and hence does not approach the thresholds for Vulnerable under the range size criterion (Extent of Occurrence <20,000 km2 combined with a declining or fluctuating range size, habitat extent/quality, or population size and a small number of locations or severe fragmentation). The population trend appears to be increasing, and hence the species does not approach the thresholds for Vulnerable under the population trend criterion (>30% decline over ten years or three generations). The population size is extremely large, and hence does not approach the thresholds for Vulnerable under the population size criterion (<10,000 mature individuals with a continuing decline estimated to be >10% in ten years or three generations, or with a specified population structure). For these reasons the species is evaluated as Least Concern.

History
  • 2008
    Least Concern
  • 2004
    Least Concern
Creative Commons Attribution Non Commercial Share Alike 3.0 (CC BY-NC-SA 3.0)

© International Union for Conservation of Nature and Natural Resources

Source: IUCN

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

National NatureServe Conservation Status

United States

Rounded National Status Rank: N1 - Critically Imperiled

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

NatureServe Conservation Status

Rounded Global Status Rank: G5 - Secure

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Wikipedia

Clay-colored Thrush

The Clay-colored Thrush (Turdus grayi) is a common Middle American bird of the thrush family (Turdidae). It is the national bird of Costa Rica, where it is well known as the yigüirro. It was known as the Clay-colored Robin until 2010.

It ranges from South Texas (where it is rapidly expanding its range) to northern Colombia; west and north of the Isthmus of Tehuantepec. It is limited to the Atlantic slope, except for a population around Oaxaca City that probably originates from escaped cagebirds.

Contents

Description

Santo Domingo, Costa Rica

In general appearance and habits it resembles other Turdus thrushes such as the American Robin. It is about the same length or slightly smaller: 23–27 cm (9-10.5 in), and weighs 74-76 g (2.6 oz.) on average. The plumage is brownish, somewhat lighter below than above, lightest on the flanks. Birds from humid regions are darker than those from dry regions. The throat is faintly streaked. Immature birds have faint mottling on the back and underparts. The bill is greenish-yellow with a dark base, the legs are pinkish or flesh-colored, and the irises are reddish---all useful identification points.

The song, rather low-pitched and with a slow steady tempo, consists of many slurred musical phrases which are often repeated irregularly. The tock flight call is like the American Robin's but harsher.

Ecology

Juvenile bird, San José, Costa Rica

In much of its range it is familiar in yards and gardens, similar to some other thrushes such as the American Robin, the Eurasian Blackbird, and the Song Thrush. In 1977, the Costa Ricans chose the yigüirro as a national symbol (over many much more colorful birds that inhabit the country) due to its strong and melodious song that always comes during the start of the rainy season. In addition, unlike many of the forest songsters of Costa Rica, the present bird has been familiar to the general population since the country's early history, thanks to the species' tendency to live near houses and settlements.[2]

The Clay-colored Thrush usually forages for fruit[3] or invertebrates on the ground or near it, singly or in pairs, but flocks may feed high in fruiting trees. It will follow army ants to feed on small prey disturbed by the ant columns.

It builds a heavy cup nest of grass, moss,feathers,leaves and mud on a firm support above the ground, which may include human constructions such as windowsills. It lays 2 to 4 pale blue eggs with red-brown and gray markings between March and July and may double-brood. It is aggressive in defense of its nest having been known to mob raptors as large as Golden Eagles, but is not otherwise particularly territorial.

Footnotes

  1. ^ BirdLife International (2012). "Turdus grayi". IUCN Red List of Threatened Species. Version 2012.1. International Union for Conservation of Nature. http://www.iucnredlist.org/apps/redlist/details/106006434. Retrieved 16 July 2012.
  2. ^ Museos de Costa Rica: Simbolos Patrios: El Yigüirro [in Spanish]. Retrieved 2007-SEP-15
  3. ^ E.g. of Trophis racemosa (Moraceae) and sometimes Gumbo-limbo (Bursera simaruba): Foster (2007).

3. Symbol of the city of San Pedro Sula,Cortes, Honduras...self-proclaimed "La Ciudad del Zorzal", in reference to the bird's local name "zorzal" which there abounds

References

Creative Commons Attribution Share Alike 3.0 (CC BY-SA 3.0)

 

Source: Wikipedia

Unreviewed

Article rating from 0 people

Average rating: 2.5 of 5

Names and Taxonomy

Taxonomy

Comments: Has been considered conspecific with T. nudigenis by a few authors (AOU 1983).

Creative Commons Attribution Non Commercial 3.0 (CC BY-NC 3.0)

© NatureServe

Source: NatureServe

Trusted

Article rating from 0 people

Average rating: 2.5 of 5

Disclaimer

EOL content is automatically assembled from many different content providers. As a result, from time to time you may find pages on EOL that are confusing.

To request an improvement, please leave a comment on the page. Thank you!